[Thunderdome]

November 2nd, 2012 by PZ Myers

This is Thunderdome, the unmoderated open thread on Pharyngula. Say what you want, how you want.

Status: UNMODERATED; Previous thread

Posted in Open Thread | 676 comments

Previous post: A Shonky poll
Next post: Truth ought to matter

676 comments on this post.

Nick Gotts (formerly KG):

November 2nd, 2012 at 6:47 am

Owlmirror,

I think I could tentatively posit that if the “system” running the scientific method became pathological, the scientific method running on that pathological system would not work

Since that sort of pathology is exactly what I’m talking about, I’m not sure why you’re arguing.

With regard to the sort algorithm, if you can’t use it because data swaps itself at random, that means it doesn’t work, even though (and this contrasts with the scientific method as you defined it) it is logically necessary that if you could implement it successfully, it always would.

Why wouldn’t the same be the case, by analogy, for the scientific method? I mean, I’m using “method” analogously to “algorithm”.

Because the scientific method is not an algorithm.

And I think a more rigorous case could be made that the scientific method is basically an algorithm; an interactive proof-system.

“Basically” here is a weasel word: as you’ve described it, and in reality, the scientific method is not invariably truth-preserving.

As I recall, you’ve argued that science does prove things — you haven’t changed your mind on that, have you?

Every time I’ve said that, I’ve made clear that it proves things in the same sense that we use in legal contexts or everyday life, not in the sense it is used in logic and mathematics.

Q.E.D:

November 2nd, 2012 at 7:13 am

Breaking News: Stonewall UK names Scottish cardinal Bigot of the Year and how I fucking hate accommodationists.

Stonewall UK has named Cardinal O’Brien “Bigot of the Year” for his relentless, outspoken calumnies against gay people and gay marriage.

Predictably everyone is scolding Stonewall for not taking a more accomodationist stance. Sponsors are threatening to yank funding.

What O’Brien said:

gay marriage is a “grotesque subversion of a universally accepted human right”. Gay relationships are “harmful to the physical, mental and spiritual wellbeing”.

He then started a defense of marriage type group to politically oppose gay rights in Scotland. When it was pointed out to him that gay marriage did no harm to him and no one was asking him to perform any, he compared the existence of gay marriage to the existence of slavery (i.e., it’s very existence is repugnant and must be fought)

Apparently we live in a society that tolerates the most outrageous bigotry as long as it is religiously motivated. And then, and fucking then, shushes people who call it out loud.

Accomodationists work hand in hand with the religious to preserve their privilege and keep their bigotry beyond reproach in polite society.

Source here

chigau (棒や石):

November 2nd, 2012 at 8:55 am

theophontes last thread
Hello-kittehz X-wing
aaawww

anteprepro:

November 2nd, 2012 at 9:26 am

Apparently we live in a society that tolerates the most outrageous bigotry as long as it is religiously motivated. And then, and fucking then, shushes people who call it out loud.

I’ll let Will Smith explain my initial reaction.

As for my serious reaction: Fuck those fuckers. Double standards, especially ones that entail turning a blind eye to bigotry and opposing people who stand up to that bigotry, piss me off to no end. Really, it is the clearest illustration with what is wrong with religious “moderates”. Hell, it is what is wrong with political “moderates”. They are perfectly silent until someone without privileges is mean enough to “sink to the level” that the assholes with privileges have been operating at the whole time. And then, suddenly, outrage and tolerance of intolerance and JUST AS BAD and why can’t we all just get along. Too bad these ubiquitous self-appointed mediators never show up until someone has the gumption to fucking fight back. When its just one-sided bullying, it apparently isn’t interesting enough for them to give a fuck. They only care when they can tut-tut BOTH SIDES. Otherwise, who cares, amirite?

jonmilne:

November 2nd, 2012 at 10:01 am

Hi guys, more help needed on an email debate. This time it’s with a YEC, and only now (after three emails from him) has he actually come up with some actual “evidence” for his claims. I’m splitting the email into three parts for easier reading. Here’s the first part:

Evolutionists tend to be fraught with “selection and elimination” examples that only put their positions in a bad light by ignoring the seminal evidence supporting the Noahic Flood and hence YEC. The Green River Shale formation is replete with fully preserved fossilized fish (especially catfish), right down to scales, eyes and other intricate detail. To avoid rot and disintegration, they would have had to have been rapidly buried. Some evolutionists have tried to counter that the alkaline condition would preserve them, but alkaline doesn’t work that way at all (CMI’s Tas Walker even commented that alkaline powder’s disintegrative properties is why it is used in dishwashers (http://biblicalgeology.net/General/QA-Topics.html), and even if that dubious statement were true, there is the further problem of avoiding scavengers, which in that hostile environment would be impossible.

As Paul Garner points out in his Answers in Genesis article, “Green River Blues,” (http://www/answersingenesis.org/articles/cm/v19/n3/green-river-blues) among the fossils are those from the extinct shorebird Presbyornis. In stating his case against an old age earth, he writes: “The Presbyornis fossils are even more problematic. Birds have hollow bones that tend not to preserve well in the fossil record. How were these bird bones protected from scavenging and decay for thousands of years until a sufficient numberof the fine annual layers had built up to bury them? ‘Enormous concentrations’ of bird bones are a clear indication that something is seriously wrong with the idea of slow accumulation. Instead, such fossils support the notion of rapid burial.” Garner’s article is well footnoted, and references include evolutionist articles as well as creationist.

As stated by ICR’s John D. Morris, few serious scientists entertain that varves are merely annual events, as bottom-hugging density flows pervade in geologic strata: “In many field observations and in laboratory experiments, multiple laminae can form almost instantaneously in simulated bottom-hugging density flows, now widely recognized as frequent throughout the geologic strata. Few knowledgeable geologists now cling to the myth of one varve equals one year.” (Morris, J. 2007. Varves: Proof for an Old Earth? Acts & Facts: 36(10): 13; http://www.icr.org/article/varves-proof-for-old-earth/) Within that article, he also validly points out the plethora of fossilized species both flora and fauna that present in the formation that are from varied habitats and could only have been washed there but a powerful cataclysm, such as bird fossils “from shorebirds to forest dwellers to ocean feeders.” There are also reptile samples from various locations as well as plants representing upland to sub-tropical species. For much the same discourse and further discussion, see also Morris’s article, “Do Millions of Laminae in the Green River Shales Document Millions of Years?” (http://www.icr.org/article/do-laminae-green-river-shales-document-millions-years/) One of his points there is that one study showed that the laminae varied in occurence by 35% between two instantaneous volcanic ash falls.

Your comments concerning the indications of more pollen in varves in the upper part of the dark layer representing spring shows a basic misunderstanding of how depositions are made, which is related much more to grain size and current or undercurrent activity. In this way, the studies of Guy Berthault should be reviewed (http://geology.ref.ac/berthault/fusion/lamination.htm), who debunks many of the fundamental misconceptions made by traditional sedimentary theory. Likewise, when catastrophes (think the Mount St. Helen’s eruption) or extreme weather conditions occur, varves form very rapidly.

Berthault, like any contrarian researcher, has his critics. One can follow the critique of Kevin R. Henke (http://www.theotokos.org.uk/pages/creation/berthault/henke.html) and Berthault’s response (http://www.theotokos.org.uk/pages/creation/berthaul/berthaul.html).

There is also a secular geologic theory that varves form diurnally due to tide activity rather than being seasonal phenomena. At http://creationwiki.org/Varve, it is reported that formations such as the Elatina Formation in South Australia (circa 250 meters thick) could have taken only 60 years to form. (Williams & Schmidt p. 21-25)(Horgan p. 11).

Plus, evolutionists completely disregard the other formations that can’t possibly be explained by Lyellian uniformitarianism. Such an example is illustrated by the John D. Morris article “The Chattanooga Shale, An Evolutionary Enigma” in the November 2012 edition of ICR’s Acts & Facts. (See http://www.icr.org/article/7075)

jonmilne:

November 2nd, 2012 at 10:08 am

This is the second and final part (my mistake) of the email I received from Mike the YEC.

The rest of your discourse, Jon, borders on the absurd. The scientific process does anything but account for its own fallibility, it tries to conceal it. It’s based on false assumptions that don’t go away because they only compound error and are tainted by a faulty world view. Uniformitarian philosophy is based on a tautology, that the age of the rocks determine the age of fossils and the age of fossils determine the age of the rocks. Secular scientists themselves have admitted that. And since science supposedly admits its fallibility, it has no moral, ethical, logical or even scientific right to preclude the possibility of a supernatural agency to account for nature or the origins of life.

So the scientific method calling for “peer” review is meaningless because founded upon an evolutionary foundation that won’t allow creationist research and findings into its narrow, bigoted scope. So biased and prejudicial “peers” censor anything challenging their sacred cow.

Darwin was an intellectually dishonest poster child whose flawed “natural selection” theory was just waiting for an excuse to be embraced by the educational and scientific community of the time more interested in escaping the dogmatism of the Anglican church than it was in objective research, even though evolution itself is more dogmatic than any organized church religion ever thought of being. He was well aware that the majority of species experienced devolution rather than evolution, as his own personal experience with giant fossils of sloths and rodents revealed. In fact, his bulldog, Thomas Huxley, died without ever acknowledging the scientific soundness of “natural selection” itself.

Even more disgracefully, Darwin failed to even properly credit creationist Edward Blyth’s description of the term (he apparently called it “artificial selection”) in a paper written in 1835 (see, e.g., ICR’s article “Natural Selection-A Creationist’s Idea” as found at http://www.icr.org/article/412) Blyth obviously utilized the concept in a far different slant than did the misdirected Darwin. Blyth saw it as preservative of species rather than as a means of transmutation. Even late evolutionist Loren C. Eiseley admitted that Darwin failed to properly acknowledge Blyth, even though Darwin did admit in his works that he valued Blyth’s opinions. Gould disputed Eiseley’s claim of misaccreditation, but this really misses the mark. The point is, “natural selection” is not the ingenius invention of Darwin by any stretch. He just perverted it to his purposes. Previous naturalists applied it in different capacities. In short, Darwin was hardly the trailblazer he is championed for, and should have directly credited Blyth rather than doing an end run.

RationalWiki’s attempt to explain the Cambrian explosion doesn’t follow logically at all. There’s no transition from soft tissue to the forms that are seen in the Cambrian explosion, although that itself is faulty because often fossils have been found out of sequence and as EBF pointed out, there is no complete stratigraphic record based on this fiction to be found anywhere on earth. Nor can traditional pseudoscience adequately explain polystrate trees without conceding they would have rotted if the strata had been laid down through gradual uniformitarian processes.

In addition, what RW says about the the Cambrian explosion, besides being fundamentally incorrect, are also totally irrelevant. The stark fact remains that just as in Darwin’s time, there is no evidence whatsoever to support transmutational macro evolution in any shape, manner or form. Nor is there evidence to support long ages, as radioisotopic measures are inherently flawed as ICR findings have conclusively shown and the stratigraphic record is much better explained in terms of catastrophic than gradual layers that defy other areas of science and observation.

There is no excuse for public schools not to present point-counterpoint comparisons between evolution and intelligent design and let the students decide for themselves. Thomas Jefferson in particular would have insisted on it for a full disclosure of the facts and the US Supreme Court case of Edwards v. Aguillard (1987) 482 US 578 would most certainly allow it (and which trumps Kitzmiller v. Dover Area School District, which featured a judge who was in way over his head, in that it was only a District Court case and really decided on different facts anyway). This paragraph capsulizes the main theme of my book, “Evolution: Reductio Ad Absurdum, and Its Meaning for Public Education” (Publishamerica, 2010).

The intellectually dishonest evos unconstitutionally control education by spinning lies and half-truths and suppress tremendous contradictory scientific research. They do so out of fear that when their “theory” is exposed to the light of day, it will be recognized by any discerning reader to be the scientific fraud that it really is. They have no shame with trying to perpetuate in public school textbooks discredited theories such as Haeckel’s recapitulation, the fraudulent horse series, Lucy, Nebraska Man, Piltdown Man, and a host of others as long as it takes to concoct a newer flawed theory that at least can up to years to totally discredit. The Big Bang itself has a severe horizon problem, but you’d never know that from most public school texts.

Both sides should be heard, not one. I say this even though I find evolution utterly preposterous because everyone must decide for themselves based on observations and facts. Anything else is brainwashing, which is what the evos are presently trying to do to our public schoolchildren and general public through our controlled and fraudulent public school system and the bought and paid for mainstream media. Unquestionably the latter is that way politically, and the school merely an extension of that political control.

So yes, as much as help as possible on this one would be enormously appreciated.

Much thanks,

Jon Milne

Q.E.D:

November 2nd, 2012 at 10:38 am

jonmilne @ 5

Brain transplant. Mike the YEC is both abusing and not using his. It should go to a needy recipient who will make good use of it.

A. R:

November 2nd, 2012 at 10:51 am

theophontes: Don’t forget the radiation beam, fact blasters, high-output stupid shields, LOLdestroyer (basically a LOL-based star destroyer) launching, LOLfighter (LOL TIE fighters) launching, and the DOG-DOGs (walker equivalents)!

chigau (棒や石):

November 2nd, 2012 at 10:53 am

jonmilne
That whole thing was an ad for his vanity press book?

jonmilne:

November 2nd, 2012 at 11:25 am

Okay, for some reason, the first part didn’t publish, here it is again:

Hi guys, more help needed on an email debate. This time it’s with a YEC, and only now (after three emails from him) has he actually come up with some actual “evidence” for his claims. I’m splitting the email into three parts for easier reading. Here’s the first part:

Evolutionists tend to be fraught with “selection and elimination” examples that only put their positions in a bad light by ignoring the seminal evidence supporting the Noahic Flood and hence YEC. The Green River Shale formation is replete with fully preserved fossilized fish (especially catfish), right down to scales, eyes and other intricate detail. To avoid rot and disintegration, they would have had to have been rapidly buried. Some evolutionists have tried to counter that the alkaline condition would preserve them, but alkaline doesn’t work that way at all (CMI’s Tas Walker even commented that alkaline powder’s disintegrative properties is why it is used in dishwashers (http://biblicalgeology.net/General/QA-Topics.html), and even if that dubious statement were true, there is the further problem of avoiding scavengers, which in that hostile environment would be impossible.

As Paul Garner points out in his Answers in Genesis article, “Green River Blues,” (http://www/answersingenesis.org/articles/cm/v19/n3/green-river-blues) among the fossils are those from the extinct shorebird Presbyornis. In stating his case against an old age earth, he writes: “The Presbyornis fossils are even more problematic. Birds have hollow bones that tend not to preserve well in the fossil record. How were these bird bones protected from scavenging and decay for thousands of years until a sufficient numberof the fine annual layers had built up to bury them? ‘Enormous concentrations’ of bird bones are a clear indication that something is seriously wrong with the idea of slow accumulation. Instead, such fossils support the notion of rapid burial.” Garner’s article is well footnoted, and references include evolutionist articles as well as creationist.

As stated by ICR’s John D. Morris, few serious scientists entertain that varves are merely annual events, as bottom-hugging density flows pervade in geologic strata: “In many field observations and in laboratory experiments, multiple laminae can form almost instantaneously in simulated bottom-hugging density flows, now widely recognized as frequent throughout the geologic strata. Few knowledgeable geologists now cling to the myth of one varve equals one year.” (Morris, J. 2007. Varves: Proof for an Old Earth? Acts & Facts: 36(10): 13; http://www.icr.org/article/varves-proof-for-old-earth/) Within that article, he also validly points out the plethora of fossilized species both flora and fauna that present in the formation that are from varied habitats and could only have been washed there but a powerful cataclysm, such as bird fossils “from shorebirds to forest dwellers to ocean feeders.” There are also reptile samples from various locations as well as plants representing upland to sub-tropical species. For much the same discourse and further discussion, see also Morris’s article, “Do Millions of Laminae in the Green River Shales Document Millions of Years?” (http://www.icr.org/article/do-laminae-green-river-shales-document-millions-years/) One of his points there is that one study showed that the laminae varied in occurence by 35% between two instantaneous volcanic ash falls.

Your comments concerning the indications of more pollen in varves in the upper part of the dark layer representing spring shows a basic misunderstanding of how depositions are made, which is related much more to grain size and current or undercurrent activity. In this way, the studies of Guy Berthault should be reviewed (http://geology.ref.ac/berthault/fusion/lamination.htm), who debunks many of the fundamental misconceptions made by traditional sedimentary theory. Likewise, when catastrophes (think the Mount St. Helen’s eruption) or extreme weather conditions occur, varves form very rapidly.

Berthault, like any contrarian researcher, has his critics. One can follow the critique of Kevin R. Henke (http://www.theotokos.org.uk/pages/creation/berthault/henke.html) and Berthault’s response (http://www.theotokos.org.uk/pages/creation/berthaul/berthaul.html).

There is also a secular geologic theory that varves form diurnally due to tide activity rather than being seasonal phenomena. At http://creationwiki.org/Varve, it is reported that formations such as the Elatina Formation in South Australia (circa 250 meters thick) could have taken only 60 years to form. (Williams & Schmidt p. 21-25)(Horgan p. 11).

Plus, evolutionists completely disregard the other formations that can’t possibly be explained by Lyellian uniformitarianism. Such an example is illustrated by the John D. Morris article “The Chattanooga Shale, An Evolutionary Enigma” in the November 2012 edition of ICR’s Acts & Facts. (See http://www.icr.org/article/7075)

jonmilne:

November 2nd, 2012 at 11:37 am

Okay, for some really irritating reason, the first part of the email I got from Mike the YEC isn’t publishing and says its “Awaiting moderation”. In any case, I’ve removed the links in case one and/or some of them violate FTB policy as “bad sites”. If it becomes okay to post the links, then I’ll be able to show what Mike the YEC said, even if I suspect his claims are crap.

Hi guys, more help needed on an email debate. This time it’s with a YEC, and only now (after three emails from him) has he actually come up with some actual “evidence” for his claims. I’m splitting the email into three parts for easier reading. Here’s the first part:

Evolutionists tend to be fraught with “selection and elimination” examples that only put their positions in a bad light by ignoring the seminal evidence supporting the Noahic Flood and hence YEC. The Green River Shale formation is replete with fully preserved fossilized fish (especially catfish), right down to scales, eyes and other intricate detail. To avoid rot and disintegration, they would have had to have been rapidly buried. Some evolutionists have tried to counter that the alkaline condition would preserve them, but alkaline doesn’t work that way at all (CMI’s Tas Walker even commented that alkaline powder’s disintegrative properties is why it is used in dishwashers (http://biblicalgeology.net/General/QA-Topics.html), and even if that dubious statement were true, there is the further problem of avoiding scavengers, which in that hostile environment would be impossible.

As Paul Garner points out in his Answers in Genesis article, “Green River Blues,” among the fossils are those from the extinct shorebird Presbyornis. In stating his case against an old age earth, he writes: “The Presbyornis fossils are even more problematic. Birds have hollow bones that tend not to preserve well in the fossil record. How were these bird bones protected from scavenging and decay for thousands of years until a sufficient numberof the fine annual layers had built up to bury them? ‘Enormous concentrations’ of bird bones are a clear indication that something is seriously wrong with the idea of slow accumulation. Instead, such fossils support the notion of rapid burial.” Garner’s article is well footnoted, and references include evolutionist articles as well as creationist.

As stated by ICR’s John D. Morris, few serious scientists entertain that varves are merely annual events, as bottom-hugging density flows pervade in geologic strata: “In many field observations and in laboratory experiments, multiple laminae can form almost instantaneously in simulated bottom-hugging density flows, now widely recognized as frequent throughout the geologic strata. Few knowledgeable geologists now cling to the myth of one varve equals one year.” (Morris, J. 2007. Varves: Proof for an Old Earth? Acts & Facts: 36(10): 13; ) Within that article, he also validly points out the plethora of fossilized species both flora and fauna that present in the formation that are from varied habitats and could only have been washed there but a powerful cataclysm, such as bird fossils “from shorebirds to forest dwellers to ocean feeders.” There are also reptile samples from various locations as well as plants representing upland to sub-tropical species. For much the same discourse and further discussion, see also Morris’s article, “Do Millions of Laminae in the Green River Shales Document Millions of Years?” One of his points there is that one study showed that the laminae varied in occurence by 35% between two instantaneous volcanic ash falls.

Your comments concerning the indications of more pollen in varves in the upper part of the dark layer representing spring shows a basic misunderstanding of how depositions are made, which is related much more to grain size and current or undercurrent activity. In this way, the studies of Guy Berthault should be reviewed, who debunks many of the fundamental misconceptions made by traditional sedimentary theory. Likewise, when catastrophes (think the Mount St. Helen’s eruption) or extreme weather conditions occur, varves form very rapidly.

Berthault, like any contrarian researcher, has his critics. One can follow the critique of Kevin R. Henke and Berthault’s response.

There is also a secular geologic theory that varves form diurnally due to tide activity rather than being seasonal phenomena. It is reported that formations such as the Elatina Formation in South Australia (circa 250 meters thick) could have taken only 60 years to form. (Williams & Schmidt p. 21-25)(Horgan p. 11).

Plus, evolutionists completely disregard the other formations that can’t possibly be explained by Lyellian uniformitarianism. Such an example is illustrated by the John D. Morris article “The Chattanooga Shale, An Evolutionary Enigma” in the November 2012 edition of ICR’s Acts & Facts.

Nerd of Redhead, Dances OM Trolls:

November 2nd, 2012 at 12:05 pm

Morris, J. 2007.

Gish Galloping here, and anything from a biblical presuppositionalist like Morris, along with all not evidenced claims POOF dismissed without evidence per the Hitchens quote. Morris presupposes the babble is inerrant, and until that is shown with solid and conclusive physical evidence from the peer reviewed scientific literature, is also dismissed.

Then have him pick his three best claims/”evidences”, and then show scientifically using the peer reviewed scientific literature that it is correct. Accept nothing but real evidence, not speculation, and nothing from any web site that presupposes biblical inerrancy, until that inerrancy is demonstrated. Say by showing a one-time-all-continent-flud-with-all-life-dying. The one-time must be shown by radiometric dating.

Rev. BigDumbChimp:

November 2nd, 2012 at 12:10 pm

He’s making lots of assertions in that first paragraph about the Green River Shale formation. Not really backing up any of them.

Owlmirror:

November 2nd, 2012 at 12:44 pm

Since that sort of pathology is exactly what I’m talking about, I’m not sure why you’re arguing.

But “all humans go so insane that they cannot remember what is real or even properly percieve what is real” isn’t quite the same thing as the scientific method itself not working as the result of a problem with the scientific method itself (which is how I understood your response to the Hovindite).

Because the scientific method is not an algorithm.

Why not? What is non-algorithmic about it?

What’s this thing running?

And I think a more rigorous case could be made that the scientific method is basically an algorithm; an interactive proof-system.

“Basically” here is a weasel word:

I admit that the idea needs fleshing out. I’m being brief, but I don’t see that I’m actually wrong.

as you’ve described it, and in reality, the scientific method is not invariably truth-preserving.

I’m not sure what you mean by that, though. Do you mean in pathological states like “reality becomes random chaos”, or even in more general non-pathological situations?

nohellbelowus:

November 2nd, 2012 at 12:51 pm

Fuck Lance fucking Armstrong and all his cowardly minions in the press.

I lived in Austin, TX for seven years, from 1997 to 2004. Lance was a major asshole, of the highest caliber.

Fuck you Lance, you stupid, lying, cheating scumbag.

(Yes, I feel better.)

Owlmirror:

November 2nd, 2012 at 1:16 pm

Because the scientific method is not an algorithm.

Why not? What is non-algorithmic about it?

(Later)

After searching Google Scholar, I came across an interesting citation (I haven’t read the whole thing yet):

Humphreys,P. Computational science and scientific method.
Minds and Machines Volume 5, Number 4 (1995), 499-512, DOI: 10.1007/BF00974980

The working definition of an heuristic that I shall use in this paper comes from a somewhat unexpected source- the psychologist R.L. Gregory.

An heuristic is a method for solving problems when no algorithm exists, using rules which involve essentially a process of trial and error.

As I understand, they’re using “heuristic” simply as being distinct from an algorithm with a specific definite output.

So would you agree that the scientific method is an heuristic?

However, it would appear that heuristics can also be considered as algorithms in a broader sense:

https://en.wikipedia.org/wiki/Heuristic_algorithm

blogofmyself:

November 2nd, 2012 at 1:44 pm

From the Lounge:

“You know, if Ann Coulter, Sarah Palin and Michele Bachmann were the leading female voices in my party, I wouldn’t trust women to make their own health care decisions either,” Feldman said.

First, I want to say that I understand that you didn’t make the joke, Rev. BigDumbChimp, so I’m not addressing any of the following criticism at you.

Now, back to the joke: I don’t like it. There are a number of problems with it.
One, everyone should have the freedom to make their own healthcare decisions, even people like Coulter and Palin. When I say that a woman should be able to choose what is best her and her family, I mean every woman. I know he was just joking, but I think it’s pretty shitty to even jokingly suggest that just because these women have ridiculous opinions on politics that they should suddenly lose autonomy over their own bodies. That’s completely absurd. Many people don’t understand anything about politics, but last time I checked that has fuck-all to do with being able to choose their own healthcare. I guarantee that no-one would joke that Paul Ryan or Ron Paul shouldn’t get to make their own healthcare decisions, no matter how ridiculous their policy positions are. Sexism toward conservative women is still sexism.

Secondly, I don’t like the idea that it’s even mildly reasonable to say, “Hey, these women are not so great, so clearly all women deserve to have their rights taken away.” Again, I know it’s a joke, but it certainly has that undertone to it. Even if he were somehow right about those women being incapable of making their own reproductive choices, that still would not have anything to do with the rights of all women. There is no context in which that kind of stereotyping is ok.

And lastly, one has to wonder why those particular women get to be the “leading female voices” in the party. Why them as opposed to, say, the GOP women who stood up for the contraception coverage mandate? Could it have anything to do with the fact that they are women who agree with the patriarchal bullshit that is the party platform? It’s a terrible feedback loop. The party is anti-choice, so the most successful women in the party are also anti-choice. Then, those anti-choice women are used as an example of why women can’t be trusted to make their own decisions, and that justifies the party being even more anti-choice than before. Making vaguely sexist jokes only feeds into the misogynistic culture that the GOP is trying so hard to preserve. Yeah, there’s some seriously misogynistic crap going on in the GOP platform, but the static level of misogyny in the general culture, the kind that jokes like that one both depend on and help to further, is what enables the GOP to keep doing what it does. I know that this joke is trying to poke fun at the sexism of the Republican party, but jokes that rely on vague sexism to work really aren’t helping.

So yeah, I get that it’s a joke about how awful Coulter, Palin, and Bachmann are, but I feel like it tacitly approves of the “I’m just going to write off all these women” attitude, and that just rubs me the wrong way.

Rev. BigDumbChimp:

November 2nd, 2012 at 1:55 pm

So yeah, I get that it’s a joke about how awful Coulter, Palin, and Bachmann are, but I feel like it tacitly approves of the “I’m just going to write off all these women” attitude, and that just rubs me the wrong way.

I agree with you. I posted that because I at first reading found it funny but after re-reading it had a feeling creep up on me about how it was still a sign of dismissal similar in the way that Anne Coulter is called Mann and Palin is judged on her looks and her family and Bachmann as well.

They all suck in their own special little ways that have absolutely nothing to do with their gender. Well… unless you consider them supporting ideas that are self harming.

But it dismisses every single other woman republican (and more).

Thanks for the comments.

LykeX:

November 2nd, 2012 at 3:05 pm

They have no shame with trying to perpetuate in public school textbooks discredited theories such as Haeckel’s recapitulation…

Ask him for examples of these things. Specific examples; titles and pages. Don’t let him run away from it or divert attention. Get him to demonstrate that this happens (which it doesn’t) or admit that he was wrong. Refuse to discuss anything else until that matter is settled.

The key thing to remember is that the average creationist doesn’t have the slightest clue about any of the subjects they pontificate on. They don’t know, they just quote. Force them to go outside the narrow scope of the quotes they’ve memorized and they quickly demonstrate their ignorance.

This also relates to another important point; don’t ever debate them on something you don’t know yourself. First, since they don’t know the subject, you’ll simply be discussing something that neither of you are qualified to talk about. Second, if you don’t know the subject, you can’t catch them when they talk shit. And they will talk shit.

Finally, don’t let him do what he’s doing: babbling on a dozen different subject at once. Select one, pin him down and keep drilling. Tell him that you’re not even going to read anything on any other subject until the present point is settled.
They love floating from subject to subject because they can then avoid going deeply into any single point. Creationist arguments are at their most convincing when kept shallow. Once you drill deep, they fall to pieces.

cm's changeable moniker:

November 2nd, 2012 at 4:12 pm

Pssst. jonmilne? You’re not going to win this argument.

Anyone who sees the teaching of evolution as a tyranical (his word) conspiracy (mine, based on: The intellectually dishonest evos [etc.]), and writes a 372-page book to show “that it is not only Constitutional to teach evolution and Intelligent Design side by side in the public schools, but that it is unconstitutional NOT to” is probably beyond hope.

That said, given:

our Founding Fathers considered the uncensored public dissemination of information the backbone of a free society

… you could run some Islamic Embryology™ up the flagpole and see if he’ll salute. ;-)

—

evil thought

You know those comedy Amazon product reviews. (women in binders, bic for her, etc.)

http://www.amazon.com/Evolution-Reductio-Absurdum-Meaning-Education/dp/1448939860

Probably not a good idea, though.

cm's changeable moniker:

November 2nd, 2012 at 5:18 pm

Shorter me: teach all the controversies!

cm's changeable moniker:

November 2nd, 2012 at 5:38 pm

theophontes:

What are the specs? You might be able to run it without the hard drive.

Toshiba Satellite L300D, 250Gb WD drive.

I’m thinking maybe 256Gb SSD, but I tried imaging it* last night without success (disk read errors, multiple CHKDSKs, etc.) so it’s not clear to me that this is a viable route. Reinstalling from scratch is probably a non-starter due to stupid recovery-from-special-partition Windows BS.

What are you thinking?

—

* By “it”, I mean the now somewhat more compliant hard drive.

glares: I’ve found your lair and I can find it again!

chigau (棒や石):

November 2nd, 2012 at 7:33 pm

I think he’s back.

Tony–Queer Duck Overlord of The Bronze–:

November 3rd, 2012 at 1:04 am

cm @21:
4 years of high school in the US.
Is that long enough to teach all the controversies?

anteprepro:

November 3rd, 2012 at 9:15 am

Ah, jonmilne, good luck. He seems like a real shark. Smart enough to know better, smarmy enough to try to spin facts into something that he prefers.

He asserts that fossils can only be preserved due to being covered rapidly without backing it up, then goes onto assume that this rapid burial could only have been Noah’s flood without realizing that this wouldn’t fit in with the timeline for these fossils AT ALL. All it takes a simple wikipedia visit to see that this Green River Shale, this place that is sufficient evidence to prove Noah’s Flood and important enough for Morris to spill much ink saying so, to see that the answer to ” How were these bird bones protected from scavenging and decay for thousands of years until a sufficient numberof the fine annual layers had built up to bury them?” was that the environment was anoxic. That these fossils were dated to the Eocene, which was more than 30 million years ago. The variety of fossils accumulated there is due to the sheer amount of time in which it could accumulate, not due to magical flood waters.

Uniformitarian philosophy is based on a tautology, that the age of the rocks determine the age of fossils and the age of fossils determine the age of the rocks.

Pay no attention to the fact that they also use dendrochronology, ice core dating, luminescence dating, and various forms of radiometric dating. And that is how they infer the age of rocks from the age of fossils, or vice versa, based upon layer, on a case by case basis. But don’t let facts get in the way of accusing science of circular logic.

His talk about the Cambrian explosion is pretty much “nuh uh”, polystrate fossils ARE explained due to rapid sedimentation but that is far cry from saying NOAH’S FLOOD, you need to have a source other than a “creation institute” to actually prove that radiometric dating is significantly flawed such that we think they are off by a factor of thousands, and even if it were true that there were many fossils that were more likely created due to catastrophic events than gradual sedimentation, the onus is on the flood believer to show that all of the instances of catastrophic sedimentation HAPPENED AT THE SAME TIME. They can’t take credit for every instance of above average rate of sedimentation and take that as proof of their magical flood. And the stuff about Darwin “stealing” his ideas from a “creationist” just shows lack of understanding about how science works. SHOCKER.

chigau (棒や石):

November 3rd, 2012 at 10:23 pm

hi joey!

theophontes (坏蛋):

November 4th, 2012 at 1:35 am

@ cm’s

I would be loathe to advise throwing good money after bad. With older machines, you cannot always say where the problems lie. What I can suggest is that you download (you might have to do this via another machine) a USB mounted OS. This will let you run everything you need on your RAM, with no need for a disk drive at all. You can also check out your system, recover files etc. [examples: Live USB-creator for Ubuntu or Knoppix on CD/DVD.]

Buying more RAM is a better way IMHO to improve performance, over SSDs. (I have three of the things, I don’t know if I’d write home about them.)

Ogvorbis: broken and cynical:

November 4th, 2012 at 9:11 am

4 years of high school in the US.
Is that long enough to teach all the controversies?

Tony, I spent five years in a four year high school and didn’t learn all the controversies.

Nick Gotts (formerly KG):

November 5th, 2012 at 6:13 am

As I understand, they’re using “heuristic” simply as being distinct from an algorithm with a specific definite output.

So would you agree that the scientific method is an heuristic? – Owlmirror

Yes. But, as I’ve already said, it is never guaranteed to achieve its aim – to eliminate error, or at least, not to introduce new errors – even when applied in the most favourable circumstances. Hence, it differs fundamentally from something like the sort algorithm, or modus ponens. Whether you want to call it an algorithm or not, this fundamental difference remains.

Nick Gotts (formerly KG):

November 5th, 2012 at 6:14 am

Owlmirror,

as you’ve described it, and in reality, the scientific method is not invariably truth-preserving.

I’m not sure what you mean by that, though. Do you mean in pathological states like “reality becomes random chaos”, or even in more general non-pathological situations?

The latter. (I’m working backwards through the thread.)

chigau (棒や石):

November 5th, 2012 at 11:59 pm

We need a troll.

theophontes (坏蛋):

November 6th, 2012 at 8:33 am

@ chigau

We need a troll.

FIFY: We desperately need a troll.

(I suspect all the ‘Merkin trolls are out there somewhere in RL, voting for rMoney.)

Rutee Katreya:

November 6th, 2012 at 8:38 am

Apropos of the Injunction by PZ, Nephilim are actually amusing as mythology. I was tickled pink when the game Dominions 3 added the Jewish man-eating giants. But you know, some of us have the sense not to consider them real XD

Ogvorbis: broken and cynical:

November 6th, 2012 at 9:10 am

Send in the trolls.
There ought to be trolls.
Don’t bother, they’re here.

erikthebassist:

November 6th, 2012 at 9:27 am

Feminzi’s are stoopid PZ is stoopid evilutionists are stoopid Ayne Rand is teh smarts Bush did 911 what about teh menz?!?!?!?! FREEZE PEACH!!!!!!!!!!!!!!

You’re welcome heads back under mah bridge

Nick Gotts (formerly KG):

November 6th, 2012 at 9:30 am

Can I ask you… is there anything that might be categorized as “woo” that you, personally, find intriguing? – scottyroberts

No; I’m too interested in real history and science. A lot of woo is dangerous – religion, and “alternative” medicine for example – as is the encouragement it all* gives – including tosh like that of the ancient alienists, which isn’t dangerous in itself – to irrationality, and to the contempt for science we see, to give the most important example, in the denial of anthropogenic climate change, and in your own contributions here.

Just curious, as a scientist, do you enjoy science fiction?

Yes. I tend to prefer that which stays closer to scientific plausibility, but that’s not an absolute rule.

That is, not in the woo itself. I am interested in why people believe in woo, and how it propagates itself and evolves over time.

chigau (棒や石):

November 6th, 2012 at 9:48 am

It’s been over an hour and a half.
Maybe scottyroberts isn’t coming.

SC (Salty Current), OM:

November 6th, 2012 at 9:48 am

Thought I’d post this here as well:

If anyone’s looking for a distraction from the election stress, I’ve replied to James Croft’s reply to my reply.

(I’m also continuing my Fromm series; theophontes, I’ll be writing much more about the problems with mysticism about 4 or 5 posts on in that series, and the intervening posts will speak to some of the points you raised here recently.)

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 6th, 2012 at 9:52 am

Can I ask you… is there anything that might be categorized as “woo” that you, personally, find intriguing?

Answered previously. I find lots of fiction fun

Just curious, as a scientist, do you enjoy science fiction?

Have you ever MET an actual scientist?

firstapproximation:

November 6th, 2012 at 11:13 am

scotty,

So, you say these ancient alien theories are fanciful wishful thinking with no evidence whatsoever and scientists are closed-minded for not taking them seriously?

Would you organize a symposium about about unicorn-riding-leprechauns-caused-the-Civil-Right-Movement theories? If not, why not?

theophontes (坏蛋):

November 6th, 2012 at 12:07 pm

@ erikthebassist

Aha! You are no doubt in the employ of the nefarious Owlmirror…

theophontes (坏蛋):

November 6th, 2012 at 12:21 pm

@ SC

Merci Beaucoup.

(I have been a bit distracted by the Great Pharyngula Movie Project* ™ . All my attempts to launch a viable LOL-star have blown up on the launchpad.)

I have a few extra additions to the discussion too. Sadly there is little help out there from the religious pundits. All the good raconteurs on that side have died out – it would seem.

I feel too, that I might have misexpressed myself – I am not that concerned with mysticism per se as with Myth. Something rather different. But yes, I am interested nevertheless.

Nick Gotts (formerly KG):

November 6th, 2012 at 12:27 pm

It’s been over an hour and a half.
Maybe scottyroberts isn’t coming. – chigau

Patience: considering how long it took him to work out how to blockquote, he probably just hasn’t found his way here yet.

Nick Gotts (formerly KG):

November 6th, 2012 at 12:32 pm

Inevitable I’d screw up the blockquote on #43, wasn’t it?

Ogvorbis: broken and cynical:

November 6th, 2012 at 12:46 pm

Nick Gotts:

Irony is fun, neh?

keresthanatos:

November 6th, 2012 at 1:10 pm

someone posted they need a troll, I gotta few minuets,

ChasCPeterson:

November 6th, 2012 at 1:19 pm

and I, gotta couple waltzes;

Glen Davidson:

November 6th, 2012 at 4:01 pm

Scotty blithering:

Evolutionary science takes as much [sic] exponential leaps of faith to make the connections as it does to say that God exists.

Around minutes 33 and 34 on the radio show. He states that he’s no creationist–apparently he’s just a dumbass who uses stupid creationist lies to make his “points.”

Glen Davidson

chigau (棒や石):

November 6th, 2012 at 4:12 pm

8 hours.
He’s not coming.

dianne:

November 6th, 2012 at 4:20 pm

8 hours.
He’s not coming.

Is it just me or is there a reenactment of “Waiting for Godot” underway in here?

chigau (棒や石):

November 6th, 2012 at 4:27 pm

Waiting for Godot
Ah.
That explains it.

John Morales:

November 6th, 2012 at 4:34 pm

The Stress of Her Regard

cm's changeable moniker:

November 6th, 2012 at 5:30 pm

So is “Civic duty accomplished” the de facto election thread?

John Morales:

November 6th, 2012 at 5:52 pm

cm, it’s not a duty in the USA. It’s an opportunity.

chigau (棒や石):

November 6th, 2012 at 6:35 pm

We desperately need a troll.

Owlmirror:

November 6th, 2012 at 7:48 pm

Eh? Wot? Nephilim?

A blast from the past (with some editing; inserted text is added):

========================

Alan Clarke began his cascade of Epic Fail @#105[of Titanoboa!] by stating that:

This phenomena of gigantism was described in the Bible before actual fossil discoveries were made: Genesis 6:4 – “There were giants in the earth in those days…”

Note, by the way, that the verse contradicts the Nicene Creed, saying: “the sons of God”. It can also been seen as contradicting the monotheism the bible is supposed to espouse; the phrase “בני האלהים” is more literally “the sons of the God”, but “God” is “Elohim”, a word which appears to be plural, but usually used in the singular when referring to the God of Israel. Yet “Elohim” is also used The phrase can just as easily be read as “the sons of the Gods“.

The Hebrew terms “נפילים” (nephilim) and “גברים” (giborim) are both translated in the LXX as “γιγαντες”, (gigantes); giants. But that latter Hebrew term should definitely be “heroes”; “mighty men” in the KJV is probably OK. “Nephilim” is harder to get an accurate sense of; “fallen ones” is suggested because of the closeness of the word to the common Hebrew term that means “fell/fallen”: “nafal”. Note that the term appears again in Numbers 13:33, in reference to the spies saying that they saw the Nephilim (again translated in the LXX as γιγαντες), “sons (or “children”) of Anak” — but “anak” is the common Hebrew term for “giant”, and in some cases, “בני” (“bene”) can have a more poetic/abstract sense of “deriving from”. ¹

So who were all these giants; heroes; “mighty men”? Well… here’s an interesting hypothesis. It is based on the simple fact that Alan is quite wrong in saying that the bible predates fossil discoveries.

There are places where fossils simply appear due to the earth shifting for various reasons. In the Gobi desert, Protoceratops and Psittacosaurus bones are eroded from hills and cliffs by the ferocious scouring of sandstorms, and have been for thousands of years; it is suggested that these are the source of the legend of the griffins, which were reported as living in the exact same area, guarding the gold that is to be found there. In the Mediterranean, storms and earthquakes can erode cliffs and hills, exposing Neogene and Pleistocene fossils of elephant-related Proboscidea (various mammoths and mastodons), the giant giraffe Samotherium, cave bears, and other large mammals.

Josephus wrote in Jewish Antiquities 5.2.3. that in the area around Hebron (Israel), the early Israelites wiped out “a race of giants, who had bodies so large and countenances so entirely different from other men, that they were surprising to the sight, and terrible to the hearing. The bones of these men are still shown to this very day, unlike to any credible relations of other men.”

Now “unlike to any credible relations of other men” suggests something genuinely strange. Not just large, but obviously different from human bones.

Once we take into account that fossils of giant animals were and are in the earth throughout the Mediterranean, and these fossils can simply erode out over time, the stories of giants in the bible, especially in the fable of the spies in Numbers 13, begin to make more sense: The ancient Israelites found these fossils and created stories about them as being the sons of the Gods and men; the original inhabitants of the land of Canaan who were fought and killed by the ancestors of the Israelites themselves.

`==begin inserted text==`
And there were also stories that were told about the fossils, in that they were from monster-men that lived before the mythical flood. Note that the rabbis noted the inconsistency that the Nephilim supposedly lived before the flood, and that the flood supposedly killed all life (including the Nephilim), and yet the Nephilim were mentioned later in the post-Exodus narratives. They came up with an ad-hoc explanation (i.e., a Midrash) that Og, father of the post-diluvian Nephilim, either sat on the ark, or was actually built a compartment inside the ark.
`==end inserted text==`

I’ve picked up the idea of biblical geomythology from reading the first chapters (and skipping a bit to find the parts about Israel) in The First Fossil Hunters, by Adrienne Mayor. She is not the first to suggest that the monsters of myth were actually fossils found by various peoples, but this is a good popular treatment of the subject. Note that she does not actually make the inference that this was the case for all myths; she tracked down references to giant bones in the Greek and Roman classical literature and correlated them with the latest known palaeontological findings. While she references the myth of the griffins and the myth of Andromeda (chained near Joppa, also in Israel) and the myth of Cyclops being a misinterpreted mammoth or mastadon skeleton, and sundry others, the specific correlation of the giants in the bible with fossils is my own interpolation, via her citation of Josephus’ description of the giant bones of Hebron.

Still, I think it quite plausible that many of the stories of giants and giant monsters all around the world may well derive from preliterate findings of millions-years-old fossils.

______________________________________________
1: Consider the English phrase “son of the desert” (Arabic “ابن الصحراء”, “Ibn al-Sahraa”). Another example in Hebrew is the common name “Ben-yamin”, meaning literally “son of the right (hand)” (or “south”, because when facing east, the south is on the right). An example in Aramaic is “Bar Kochba”; “son of a star”.

Owlmirror:

November 6th, 2012 at 7:52 pm

Editing FAIL.

Yet “Elohim” is also used to refer to “gods”, in the plural (Exodus 20:3 being an obvious example).

FTFM

erikthebassist:

November 6th, 2012 at 8:16 pm

theophontes,

Who is this owlmirror you speak of? looks up

oh hir? never met hir and you can’t prove that I have.

cm's changeable moniker:

November 6th, 2012 at 8:22 pm

`O R S T B E H R S B N O E P N Y`

That should do it …

cm's changeable moniker:

November 6th, 2012 at 8:46 pm

(That was courtesy of http://www.fun-with-words.com/boggle.html)

I have, at the very least, “throbs”. ;-)

erikthebassist:

November 6th, 2012 at 9:15 pm

troy jumped out at me

erikthebassist:

November 6th, 2012 at 9:17 pm

these

erikthebassist:

November 6th, 2012 at 9:17 pm

throne

erikthebassist:

November 6th, 2012 at 9:18 pm

tron of course, are proper names allowed?

erikthebassist:

November 6th, 2012 at 9:20 pm

norse

erikthebassist:

November 6th, 2012 at 9:22 pm

horses, longest so far, ok, I’m ahead by one cm. Done for now.

Ichthyic:

November 6th, 2012 at 9:27 pm

Evolutionary science takes as much [sic] exponential leaps of faith to make the connections as it does to say that God exists.

that website hurts my eyeballs.

why is it that all these fucking paranormal woomeisters ALWAYS have such glaringly bad websites?

Ichthyic:

November 6th, 2012 at 9:30 pm

We desperately need a troll.

wads up stinkiest cheese bait in the tackle box
…

Venture capitalism is the only way to revitalize the American global economy in the 21st century.

prove me wrong.

cm's changeable moniker:

November 6th, 2012 at 9:32 pm

thrones

Hah! (You should always look for plurals!)

erikthebassist:

November 6th, 2012 at 9:42 pm

thrones

Hah! (You should always look for plurals!)

Throners? (those who occupy thrones I presume. ;)

Tony–Queer Duck Overlord of The Bronze–:

November 6th, 2012 at 9:44 pm

Uh oh. It’s bad when you’re playing word games.
Maybe PZ can hire someone to troll the Thunderdome.
Perhaps an ad in Craigslist (heck it might be funny creating an ad seeking a troll).

Owlmirror:

November 6th, 2012 at 9:45 pm

shorn
horny
bores
shone
obese
berobe
thorny
resh
beorst
hones
honer
honest
none
short
Thebes

cm's changeable moniker:

November 6th, 2012 at 9:46 pm

[M]eet 21-year-old Galicia Malone.

The south suburban Dolton mom-to-be was spotted at her polling place Tuesday morning on her way to give birth at a local hospital.

Cook County Clerk David Orr said Malone’s contractions were five minutes apart when she showed up around 8:30 a.m. at her precinct’s location named, yes, New Life Celebration Church.

http://www.dailykos.com/story/2012/11/06/1156892/-Too-tired-or-lazy-to-vote-Get-over-it

admiration and best wishes for safe delivery

Owlmirror:

November 6th, 2012 at 9:48 pm

(whaddaya mean, no hebrew or anglo-saxon?)

cm's changeable moniker:

November 6th, 2012 at 9:51 pm

(See? It’s like a summoning spell.)

theophontes (坏蛋):

November 6th, 2012 at 9:59 pm

@ erikthebassist

oh hir? never met hir and you can’t prove that I have.

Your denial has been recorded and will be used in evidence against you.

@ Tony

Maybe PZ can hire someone to troll the Thunderdome.

We currently have Public Enemy Number One ™ posting as you type.

@ Owlmirror

See what you did – bringing reason and good argument into the Thunderdome: You have scared away the trolls.

cm's changeable moniker:

November 6th, 2012 at 10:27 pm

Ohio has been called for Barack Obama.

phew

Owlmirror:

November 6th, 2012 at 11:05 pm

Ohio has been called for Barack Obama.

Huh.

Right this moment, the two maps I’m looking at both have Ohio for Romney.

But they also have 270(+) electoral votes for Obama.

Owlmirror:

November 6th, 2012 at 11:13 pm

No, wait, now Ohio has flipped back to Obama in the lead.

Ichthyic:

November 6th, 2012 at 11:16 pm

Ohio has been called for Barack Obama.

it actually doesn’t matter any more.

Obama got colorado and nevada.

done.

cm's changeable moniker:

November 6th, 2012 at 11:19 pm

Don’t forget Hawaii. ;-)

The timezones are still working …

chigau (棒や石):

November 6th, 2012 at 11:51 pm

scottyroberts
scottyroberts
scottyroberts

Tony–Queer Duck Overlord of The Bronze–:

November 7th, 2012 at 8:59 am

chigau:
I think you need a mirror for that to work…

Ogvorbis: broken and cynical:

November 7th, 2012 at 9:14 am

scottyroberts
scottyroberts
scottyroberts

No, not you, Michael Keaton.

chigau (棒や石):

November 7th, 2012 at 9:15 am

Tony
Do I hold the mirror up to the camera?
Or what?

chigau (棒や石):

November 7th, 2012 at 9:24 am

No, not you, Michael Keaton.

Unless…

Owlmirror:

November 7th, 2012 at 9:43 am

@Nick Gotts:

But, as I’ve already said, it is never guaranteed to achieve its aim – to eliminate error, or at least, not to introduce new errors – even when applied in the most favourable circumstances.

Well… how do you know that there is error? If you’re testing for it, and you find it, the whole point of the method is to eliminate the error. If you’re testing for it, and not finding it, how do you know that it is actually error?

This is why we run multiple instances (peer review; broad consensus-seeking) of the method (or heuristic); even if one instance fails to find actual error, another instance should catch it. I think it might be possible to argue that multiple instances of the heuristic, run over multiple iterations, should have ever-diminishing amounts of error.

As with any algorithm that involves stochastic systems and methods, no, truth is not guaranteed. But I think you can show that it is highly improbable that error will remain and/or accumulate, especially in a scenario with many parallel and serial instances of the heuristic.

We should indeed continue to hold the results of the method provisionally, but I think we can be confident that the method will, over successive iterations, increase our confidence in those results. And for any failure of confidence in the results due to actual error, well, it is exactly the scientific method (working properly) that will find those failures.

chigau (棒や石):

November 7th, 2012 at 10:05 am

Fuck snow.

Owlmirror:

November 7th, 2012 at 10:48 am

Fuck snow.

kaniktshaq moritlkatsio atsuniartoq

“Observe the snow. It fornicates.”

Nick Gotts (formerly KG):

November 7th, 2012 at 10:55 am

Well… how do you know that there is error? If you’re testing for it, and you find it, the whole point of the method is to eliminate the error. If you’re testing for it, and not finding it, how do you know that it is actually error? – Owlmirror

Come on: you don’t have to know there is error in any particular case to know that there will almost certainly be errors in some cases (if there were none, that could only be the result of magic).

I don’t have any disagreement with the rest of your latest comment.

Nick Gotts (formerly KG):

November 7th, 2012 at 11:00 am

Now “unlike to any credible relations of other men” suggests something genuinely strange. Not just large, but obviously different from human bones. – Owlmirror

An elephant’s skull has a single large hole in the upper centre which could easily be mistaken for a single eye-socket. It’s actually where the trunk was in life.

Owlmirror:

November 7th, 2012 at 11:52 am

An elephant’s skull has a single large hole in the upper centre which could easily be mistaken for a single eye-socket. It’s actually where the trunk was in life.

Yes, Adrienne Mayor specifically connects the cyclops to misinterpreted elephant/mammoth skulls, and I recall that she cites earlier works that made the same connection.

Some Proboscideans looked very weird indeed. If someone didn’t know much about zoology, a Deinotherium skull might look like some sort of horrible troll with huge eyes, a huge nose and a bizarre horned chin.

Owlmirror:

November 7th, 2012 at 12:25 pm

Nifty!

New intro to Mayor’s book, detailing the effects of the first edition on the scholarship and understanding of palaeontology and history:

http://www.stanford.edu/dept/HPST/MayorFFH2011.pdf

Owlmirror:

November 7th, 2012 at 4:54 pm

Come on: you don’t have to know there is error in any particular case to know that there will almost certainly be errors in some cases

And yet, that’s not quite how I think it ought to be phrased. What is left after each case is uncertainty; lack of knowledge as to whether there is actual error or actual correctness. That’s not quite the same thing as being certain that there is actual error.

A. R:

November 7th, 2012 at 6:39 pm

theophontes: Chilly day here.

cm's changeable moniker:

November 7th, 2012 at 6:49 pm

Cindy Clendenon’s Hydromythology and the Ancient Greek World analyzes Greek myths in terms of karst geology. Fossil folklorist Christopher Duffin combines geology, medicine, and popular lore in articles on the history of medical uses of invertebrate fossils. In The Star-Crossed Stone, paleontologist Kenneth McNamara surveys the cultural history of sea urchin fossils from Neolithic times to the present.

Karst topography? Fossils as medicine? Echinoids in culture?!

Curse you, Owlmirror, for adding to my Amazon wishlist. scowls

Jessa:

November 7th, 2012 at 7:40 pm

Word games in [Thunderdome]?

shakes head

That troll bait had better work soon, before someone starts a game of Hangman.

theophontes (坏蛋):

November 7th, 2012 at 10:16 pm

@ A.R #95

Your sekrit mesarge failed to transmit.

chigau (棒や石):

November 7th, 2012 at 10:17 pm

We had fifteen fucking centimetres of snow.
I invite the little red wiggly underline to bite my crank.

A. R:

November 7th, 2012 at 10:42 pm

theophontes: Odd.

erikthebassist:

November 8th, 2012 at 12:57 am

Hey did you know Obama won?

theophontes (坏蛋):

November 8th, 2012 at 3:26 am

@ A.R

Perhaps you can work out where I am going wrong. The LOL-star turns about 10 degrees and then starts playing loud disco music from the 70′s. Is this a bug or a feature?

PS: I discovered I can post ogg-vobis (no relation) video on hotmail from within China. You can download LOL-star video here: Linky and play on computer.

…
I won on the horses yesterday. Yay! (Don’t tell cicely.)

Rutee Katreya:

November 8th, 2012 at 7:46 am

For those just chomping at the bit for trolls, there are some low quality misogynists on the EXTERMINATE! thread.

Not a lot to bat around though.

A. R:

November 8th, 2012 at 6:09 pm

theophontes: Video was non-functional. It just opened Windows Movie Maker. Oh, and the LOLstar plays the Meow Mix jingle.

strange gods before me ॐ:

November 8th, 2012 at 6:53 pm

Come to think of it, the One Holey Cadaveric Vitriolic Church of Quantum Boltzmannbrontosaurusism needs its own military capacity. I shall have to commandeer the LOLstar.

[A. R fires low-yield LOLbeam at SG]

BOOM!

:)

It worked: I lol’d.

theophontes (坏蛋):

November 8th, 2012 at 10:44 pm

@ A.R

Video was non-functional.

That is strange. Perhaps it is a Windows ™ thing. You may have to download VLC (the best!) to play .ogg files. I will be in Honkers this weekend, so can post to youtube (which takes .ogg files).

Link to VLC (It is an omnipotent player, it can handle everything out there.) If that doesn’t work, you’ll have to resort to offering libations to the Boltzmann Brontosaurus.

theophontes (坏蛋):

November 8th, 2012 at 11:11 pm

@ SGBM

Cliquez ici!

chigau (棒や石):

November 8th, 2012 at 11:43 pm

I cannot believe that the FrenchLanguageCops will let “Cliquez” go unchallenged.

theophontes (坏蛋):

November 9th, 2012 at 1:58 am

@ chigau

cough Porkwuz non?

Tony–Queer Duck Overlord of The Bronze–:

November 9th, 2012 at 3:11 am

I find it curious that SteveoR won’t come here to hash out his problems. Instead, he’d rather appropriate The Lounge for his purposes, and fuck everyone else… or he’ll derail a thread. He doesn’t want to come here because it’s unrestrained and there are no rules?! The one place you can come and argue for eternity, but just because people talk to him however they want, he won’t venture in? That seems to be a cowardly move.

John Morales:

November 9th, 2012 at 4:28 am

Tony, you must have experience with belligerent drunken people who nonetheless avoid actual confrontation when actual fisticuffs appear likely. :)

Tony–Queer Duck Overlord of The Bronze–:

November 9th, 2012 at 4:32 am

John:
you’d be surprised. The belligerent drunks I’ve encountered didn’t avoid fights when it came to that (I was never involved in any, but I’ve watched them break out in various bars I’ve worked). Usually security guards have to be called over to stop a fight from breaking out, or breaking one up. Funny thing-all the fights I can recall involved guys fighting over a girl.

John Morales:

November 9th, 2012 at 4:42 am

Ah, fair enough, Tony. I’m not much of a bar person, so my experience is limited to social events, and not many of those at that.

Giliell, Approved Straight Chorus:

November 9th, 2012 at 4:43 am

Tony

Funny thing-all the fights I can recall involved guys fighting over a girl.

Because just asking her is too much trouble.
Yeah, another data-point in the endless sea of “many guys see women as property, not as people”

SC (Salty Current), OM:

November 9th, 2012 at 1:32 pm

My fourth reply to James Croft. I sincerely hope we’re getting somewhere.

chigau (棒や石):

November 9th, 2012 at 8:45 pm

I’m bored.
Amuse me.

imkindaokay:

November 9th, 2012 at 9:06 pm

Peter Hitchens is coming to my uni.

He’s said so many wrong things, I dunno which one I should focus on (presuming I only get one question).

Whaddya think I should ask him about?

John Morales:

November 9th, 2012 at 9:30 pm

imkindaokay, what are the three most wrong yet easily refutable things he’s said, and can you rank them by any criteria?

(If you can do both the above, then you should probably focus on the most highly ranked)

imkindaokay:

November 9th, 2012 at 10:05 pm

I suppose

1) Antidepressants make people kill other people
2) Breast cancer is caused by lack of pregnancy (not even abortions … just not getting pregnant)
3) Drunk victims of rape are as culpable as drunk drivers
but then also
4) We shouldn’t have fought in WWII because it made us lose our empire
5) Teachers who teach sex-ed are as bad as paedophiles and that sex ed is child grooming, sexualising the youth, and leading to higher rates of teen pregnancy (though lack of pregnancy is causing a breast cancer epidemic)

they’re all so bad, I just do not know

A. R:

November 9th, 2012 at 10:33 pm

imkindaokay: Go after 2 and 3, 5 if you have time and/or fact gun ammunition left.

imkindaokay:

November 9th, 2012 at 10:54 pm

I was thinking that 3 is probably the most serious; but 1 affects me personally and is something I know more about. 3 might be better handled by superior feminists than I.

I dunno why he’s allowed to come, he’s a really shit person.

chigau (棒や石):

November 9th, 2012 at 11:10 pm

imkindaokay
Ask Peter Hitchens if he believes that Jesus Christ is returning in his (Peter Hitchens) lifetime.

imkindaokay:

November 9th, 2012 at 11:20 pm

Where has he said that?

John Morales:

November 9th, 2012 at 11:23 pm

imkindaokay,

I was thinking that 3 is probably the most serious; but 1 affects me personally and is something I know more about. 3 might be better handled by superior feminists than I.

There you have it. :)

–

I do encourage you to take advantage of this opportunity to incommode him!

(Gunga Din!)

chigau (棒や石):

November 9th, 2012 at 11:31 pm

imkindaokay
Perhaps he hasn’t said it, yet.
If you get a chance, ask him.

imkindaokay:

November 9th, 2012 at 11:31 pm

‘Ayn Rand, another liberal’ he says.

What an absolute shart.

theophontes (坏蛋):

November 10th, 2012 at 3:26 am

@ imkindaokay

What an absolute shart.

I am scared to ask. Particularly as the word is being used to describe Peter Hitchens.

Giliell, Approved Straight Chorus:

November 10th, 2012 at 3:51 am

imkindaok
Well, for 5 you have a lot of solid, empirical data to beat him over the head with.

John Morales:

November 10th, 2012 at 4:22 am

theophontes, you know when you think you’re doing a fart, but it comes out liquid?

(Yeah, that’s a shit fart — or a shart for short)

John Morales:

November 10th, 2012 at 4:39 am

… But a fetus is not a fecal flatus.

imkindaokay:

November 10th, 2012 at 11:52 am

Shart is my new word of choice.

But anyway, @Giliell, do you have any specific like, tables of rates of teenage pregnancy by country/state and tables of what a country’s/state’s sex ed is like (or know where to find them?) I’ve been looking and I can’t find anything that’s really just in your face about it.

imkindaokay:

November 10th, 2012 at 11:56 am

Well I can find the pregnancy ones; but not in comparison to comprehensiveness of sex ed (or whatever)

Rev. BigDumbChimp:

November 10th, 2012 at 12:46 pm

theophontes, you know when you think you’re doing a fart, but it comes out liquid?

(Yeah, that’s a shit fart — or a shart for short)

One question you never want to ask yourself

Do farts have lumps?

That concludes rev bdc’s grade school philosophy question of the day.

Giliell, Approved Straight Chorus:

November 10th, 2012 at 1:49 pm

Imkindaok
How about this: http://ari.ucsf.edu/science/reports/abstinence.pdf

or this: http://www.jahonline.org/article/S1054-139X%2807%2900426-0/abstract

Google IS your friend ;)

Ogvorbis: broken and cynical:

November 10th, 2012 at 2:54 pm

Do farts have lumps?

Yes, Reverend, they sometimes do. Of course, when they have lumps, they are not sharts, they are limbaughs.

LykeX:

November 10th, 2012 at 2:59 pm

I thought lumpy farts were the ones that went FFFFTHLBTHLBTHLBTHLBTHLBTHLBTHLBTHLB!

A. R:

November 10th, 2012 at 4:16 pm

[A. R is concerned, considers the effect of discussion of flatulence on teh tardigrade's work on "Pharyngula, the Motion Picture."]

chigau (棒や石):

November 10th, 2012 at 4:41 pm

A. R
I didn’t even know tardigrades could get flatulence.

Tony–Queer Duck Overlord of The Bronze–:

November 10th, 2012 at 4:46 pm

Oggie:
when does a Limbaugh become a Santorum?

John Morales:

November 10th, 2012 at 4:51 pm

Thought for the day: when you smell someone’s fart, you’re inhaling particles of poo.

strange gods before me ॐ:

November 10th, 2012 at 4:58 pm

Please fill in the blank (yes, dear reader, I’m asking you).

Language is all the way down.

+++++
theophontes, I cliquezed. It was cute. :)

chigau (棒や石):

November 10th, 2012 at 5:02 pm

Language is particles all the way down.

Tony–Queer Duck Overlord of The Bronze–:

November 10th, 2012 at 5:03 pm

this is what the Thunderdome has become.
A place to talk shit…
hee hee…

John Morales:

November 10th, 2012 at 5:11 pm

I am lazy.

Language is all the way down.

Owlmirror:

November 10th, 2012 at 5:22 pm

Duh.

Language is recursion all the way down.

cm's changeable moniker:

November 10th, 2012 at 6:42 pm

Are we debating langue vs. parole?

Anyhow, I’m reliving War of the Worlds.

It’s like time travel. I have been transported to my past.

Tony–Queer Duck Overlord of The Bronze–:

November 10th, 2012 at 6:50 pm

John @144:
Nice.
There were many choices there.
Michele Malkins’ was ironic.

broboxley OT:

November 10th, 2012 at 7:05 pm

shameless promotion
My kid has been bugging me to promote his site. I said I would link it once
so for woo flavored coffee go to
http://www.oxleycoffee.organogold.com/
or if you just want to laugh and point at the woo go there
otherwise feel free to ignore
thank you for your forebearance

chigau (棒や石):

November 10th, 2012 at 7:20 pm

broboxley
I clicked.
I looked.
Nutraceuticals?
and
what is the problem with Binomial nomenclature?

chigau (棒や石):

November 10th, 2012 at 7:38 pm

oh and re: language
from Pffft

Head finality in Japanese sentence structure carries over to the building of sentences using other sentences. In sentences that have other sentences as some of their constituents, the subordinated sentences (relative clauses, for example), always precede what they refer to, since they are modifiers and what they modify has the syntactic status of phrasal head. Translating the phrase the man who was walking down the street into Japanese word order would be street down walking man. (Note that Japanese has no articles, and the different word order obviates any need for the relative pronoun who.)

Now. Wasn’t that helpful?
http://en.wikipedia.org/wiki/Japanese_grammar

Ogvorbis: broken and cynical:

November 10th, 2012 at 8:20 pm

chigau:

That explains the instructions that come with some of the scale models I build.

chigau (棒や石):

November 10th, 2012 at 9:04 pm

Ogvorbis
Even with all my dictionaries I still wonder why the Japanese recipes want me to put the daikon and salt in my bed or possibly my floor.
(wait. they mean put the daikon and salt in a large, flat container)

Ogvorbis: broken and cynical:

November 10th, 2012 at 9:09 pm

(wait. they mean put the daikon and salt in a large, flat container)

A kitty litter box?

chigau (棒や石):

November 10th, 2012 at 9:20 pm

If I put daikon and salt in the kitty litter box, the kitty would probably “litter” in my bed or on the floor.

theophontes (坏蛋):

November 11th, 2012 at 2:16 am

@ John Morales

Thought for the day: when you smell someone’s fart, you’re inhaling particles of poo.

Thank you John… {starts turning green}

Turn sound up and clicky: Link.

John Morales:

November 11th, 2012 at 2:28 am

theophontes, such petophony mightily amuses the prepubescent child I once was.

(Kids are so lucky these days!)

Tony–Queer Duck Overlord of The Bronze–:

November 11th, 2012 at 3:04 am

“once was”…?

theophontes (坏蛋):

November 11th, 2012 at 3:13 am

@ All

[Orania]

I wrote an email to the committee in Orania to see what they are about, they wrote back to me:

Mnr Phontes

Ek heg ‘n pamflet aan. As jy meer inligting verlang kan jy gerus jou posadres verskaf dan pos ons meer materiaal. *

Groete,

John Strydom

Adjunk-uitvoerende hoof

Their pamflet is here: Link.

It is so sad. These are otherwise good, down-to-earth people. They just have this big blockage in the brain that compels them to be inveterate racists. If we could somehow just remove that … :’(

* (Translation: I attach a pamphlet. If you wish for more information, feel free to send your postal adress, then we will send more material.)

John Morales:

November 11th, 2012 at 3:23 am

Tony, the child is gone — has become me — but I still like to please him.

(No, it’s not rational)

theophontes (坏蛋):

November 11th, 2012 at 3:26 am

@ A.R

Yes, the farty conversation has distracted me from the more serious work of finding non-farty soundeffects for the movie. Here are the latest film rushes from the set: Link to Pharyngula: The Movie.

After no responses from the lolstar, we sent an Xwing round to see what was the matter. We seem to have got at least one LOLmeerkat up and running. (Teh kittehz snoozez too much.)

theophontes (坏蛋):

November 11th, 2012 at 8:27 am

@ John Morales

I think that I can honestly say, that it is the child in me that pays the bills.

McC2lhu doesn't want to know what you did there.:

November 11th, 2012 at 10:16 am

As if you needed more insight into the GOP mentality during the recent big elections (no Miss Collins, I said big eLections!) perhaps a pair of red-state spex will illuminate matters.

I see that I have brought this subject up at the most opportune time, considering the discussion about teh phartz. “Phactz” emanating from the Rethuglicans seem to have been pulled directly from the bum as well.

cm's changeable moniker:

November 11th, 2012 at 4:38 pm

I took the 4-year-old to a birthday party today.

Now I have S-Club 7 – Don’t Stop Moving in my head.

I think it’s like The Ring. If I can make you hear it, I won’t die.

theophontes (坏蛋):

November 12th, 2012 at 1:41 am

{dr theophontes feels Teh Thunderdome’s pulse}

Stone cold daaid!

McC2lhu doesn't want to know what you did there.:

November 12th, 2012 at 7:41 am

cm’s changeable moniker @163:

Of course you’re going to have it stuck in your head. Every component of the tune is something you’ve heard before and are familiar with.

The opening bass-line is almost verbatim Michael Jackson’s ‘Billy Jean’ to hook you.

The chorus is sung as if ABBA had been reincarnated and brought a hefty chunk of ‘Summernight City’ with them.

The string sections are nothing but ’70s disco kitsch.

Whoever produced this knew exactly what they were doing, and they are very evil, evil people.

Rev. BigDumbChimp:

November 12th, 2012 at 7:53 am

Now I have S-Club 7 – Don’t Stop Moving in my head.

I can say that I’m pretty damn sure I’ve never heard that song before

A. R:

November 12th, 2012 at 8:17 am

theophontes: Sorry about snubbing the X-wing, but the crew as a bit intoxicated from Friday night…

chigau (棒や石):

November 12th, 2012 at 9:09 am

Not dead.
Resting.

Rutee Katreya:

November 12th, 2012 at 9:21 am

Apropos of nothing but my loading up firefox to an old thread, I need to really stop playing along with fool misogynists who whine about radfemhub as if it’s concentrated evil. For the second time, I just looked over radfemhub in detail. Predictably, even the radical feminists don’t really say anything that bad about dudes. I mean, they’re total assholes to WoC (Not on today’s check, but the previous one I did, christ.), the poor, and trans women, but dudes who act like they’re the satan of feminism really have no idea how good they have it.

Compare that shit to stormfront, or some other actual oppressive group and it just… doesn’t work. I need to stop taking it as a given that they’re total shit to dudes. And this is the second time I had to remind myself of this =.=;

anteprepro:

November 12th, 2012 at 9:41 am

Predictably, even the radical feminists don’t really say anything that bad about dudes.

Yep. If there is one thing that is reliable in this world, it is non-feminists completely mischaracterizing feminists. Don’t worry about having to remind yourself, though. Verification is what good skeptics do.

theophontes (坏蛋):

November 12th, 2012 at 10:51 am

@ AR

[X-wing]

intoxicated from Friday night…

No-one has ever flown one sober…

@ chigau

Not dead.
Resting.

You mean a zombie thread?

cm's changeable moniker:

November 12th, 2012 at 6:26 pm

A. R, yes, that, and the fact I’ve heard the song about a thousand times. And know all the words. shame

(The chord progression in the bridge is neat, though.)

chigau (棒や石):

November 12th, 2012 at 7:30 pm

The recent trolls in the other threads have been pathetic.
No staying power, at all!

cm's changeable moniker:

November 12th, 2012 at 8:41 pm

The string sections are nothing but ’70s disco kitsch.

Heh. November 4, 1997:

WASHINGTON, DC—At a press conference Monday, U.S. Retro Secretary Anson Williams issued a strongly worded warning of an imminent “national retro crisis,” cautioning that “if current levels of U.S. retro consumption are allowed to continue unchecked, we may run entirely out of past by as soon as 2005.

[...]

The National Retro Clock currently stands at 1990, an alarming 74 percent closer to the present than 10 years ago, when it stood at 1969.

Nowhere is the impending retro crisis more apparent, Williams said, than in the area of popular music.

U.S. Dept. Of Retro Warns: ‘We May Be Running Out Of Past’

chigau (棒や石):

November 12th, 2012 at 9:11 pm

I would like another disappearing complaints thread.

Owlmirror:

November 12th, 2012 at 9:16 pm

The recent trolls in the other threads have been pathetic.
No staying power, at all!

yesyouneedmyimaginaryfriend is only brave when bobenyart is around.

strange gods before me ॐ:

November 12th, 2012 at 9:38 pm

There’s some radical feminists here at Pharyngula too, of whom Radfem Hub is not at all representative.

+++++
Via John’s lazy link, my favorite “language is” so far:

“religious language is ashram cats all the way down.”

chigau (棒や石):

November 12th, 2012 at 9:45 pm

From an old link I saved
ashram temple cats
http://youneedacat.tumblr.com/post/20350463591/tehfawx-tempus-teapot-myjusticecake

strange gods before me ॐ:

November 12th, 2012 at 9:48 pm

eep

pretty fur though

strange gods before me ॐ:

November 12th, 2012 at 10:18 pm

Leon Arnott reveals:

While thinking about it, I looked up the etymology of ‘henchman’, and it’s apparantly “from man + O.E. hengest ‘horse, stallion, gelding.’” I guess that proves it, then – the English language really is horses all the way down.

chigau (棒や石):

November 12th, 2012 at 10:28 pm

So, how does that “hengest”=”stallion” and “gelding” thing work?
JAQ ;)

strange gods before me ॐ:

November 12th, 2012 at 10:51 pm

http://en.wikipedia.org/wiki/auto-antonym

Each such word has its own funny history. If the word really had those specific meanings rather than simply referring to a broad category (the “Online Etymology Dictionary” is not as reliable as its author makes it look), I suppose it would have first been applied to one, and somewhere this would be understood as a word conveying information about horse balls or maleness, which is then used regarding the other.

But, ask pelamun.

Jadehawk:

November 12th, 2012 at 10:56 pm

So, how does that “hengest”=”stallion” and “gelding” thing work?

if it’s just a word for a male horse, then it would be a word for both the castrated and the uncastrated kind of male horse, no?

does english have a word that applies to all male horses?

chigau (棒や石):

November 12th, 2012 at 10:57 pm

ॐ
Sometimes I surprised that We(as language-using-homonimidsoids) can communicate, at all.
I’d like to ask pelamun but he doesn’t do TZT any more.

strange gods before me ॐ:

November 12th, 2012 at 11:14 pm

if it’s just a word for a male horse, then it would be a word for both the castrated and the uncastrated kind of male horse, no?

This is my first guess, that the etymology guy’s style of writing makes the meaning appear more specific than it was.

does english have a word that applies to all male horses?

Horse, I think, as opposed to mare, in some archaic conventions. But I’m not sure; it still might not have applied to geldings.

+++++
chigau: I wonder if very much communication really goes on. Sometimes I think we’re sitting together and talking to ourselves. Which is still nice.

strange gods before me ॐ:

November 12th, 2012 at 11:18 pm

I find this both annoying and worth knowing.

http://pss.sagepub.com/content/early/2012/09/23/0956797612445312.short

In the study reported here, we investigated whether covertly manipulating positive facial expressions would influence cardiovascular and affective responses to stress. Participants (N = 170) naive to the purpose of the study completed two different stressful tasks while holding chopsticks in their mouths in a manner that produced a Duchenne smile, a standard smile, or a neutral expression. Awareness was manipulated by explicitly asking half of all participants in the smiling groups to smile (and giving the other half no instructions related to smiling). Findings revealed that all smiling participants, regardless of whether they were aware of smiling, had lower heart rates during stress recovery than the neutral group did, with a slight advantage for those with Duchenne smiles. Participants in the smiling groups who were not explicitly asked to smile reported less of a decrease in positive affect during a stressful task than did the neutral group. These findings show that there are both physiological and psychological benefits from maintaining positive facial expressions during stress.

A. R:

November 12th, 2012 at 11:40 pm

What if I told you peoples that I have access to pelamun?

strange gods before me ॐ:

November 12th, 2012 at 11:44 pm

I would say to tell pelamun we have a question about horse testicles.

Also hi how’s it going. :)

A. R:

November 12th, 2012 at 11:49 pm

The question has been asked, and a response shall be posted as soon as it becomes available.

Rutee Katreya:

November 12th, 2012 at 11:49 pm

There’s some radical feminists here at Pharyngula too, of whom Radfem Hub is not at all representative.

Yeah, but I don’t see the need to play “But we’re not like THEM” in regards to entirely fictional man-hating. The problems with radical feminists as a whole, including radfemhub, relate to cascading kyriarchy fail. Even the great radfem satan doesn’t ‘hate men’. Which is pretty a rich charge coming from the people most likely to cite radfemhub as feminist satan at any rate.

And just so we’re clear, I identified as a radical feminist until it became clear just how little they cared for WoC, trans women, poor women and the like.

chigau (棒や石):

November 12th, 2012 at 11:58 pm

On an episode of one of the CSI TV shows, one of the characters was carrying a bucket of spit-blood-mucus and smiling.
Questioned by one of her colleagues about her facial expression, she responded.
“Smiling suppresses the gag reflex.”
—
So that was true?

strange gods before me ॐ:

November 12th, 2012 at 11:58 pm

Yeah, but I don’t see the need to play “But we’re not like THEM” in regards to entirely fictional man-hating.

Aye, I mean it in regard to transphobia et cetera.

strange gods before me ॐ:

November 13th, 2012 at 12:10 am

Urgh.

http://pss.sagepub.com/content/17/10/847.abstract

Traditionally, prejudice has been conceptualized as simple animosity. The stereotype content model (SCM) shows that some prejudice is worse. The SCM previously demonstrated separate stereotype dimensions of warmth (low-high) and competence (low-high), identifying four distinct out-group clusters. The SCM predicts that only extreme out-groups, groups that are both stereotypically hostile and stereotypically incompetent (low warmth, low competence), such as addicts and the homeless, will be dehumanized. Prior studies show that the medial prefrontal cortex (mPFC) is necessary for social cognition. Functional magnetic resonance imaging provided data for examining brain activations in 10 participants viewing 48 photographs of social groups and 12 participants viewing objects; each picture dependably represented one SCM quadrant. Analyses revealed mPFC activation to all social groups except extreme (low-low) out-groups, who especially activated insula and amygdala, a pattern consistent with disgust, the emotion predicted by the SCM. No objects, though rated with the same emotions, activated the mPFC. This neural evidence supports the prediction that extreme out-groups may be perceived as less than human, or dehumanized.

chigau (棒や石):

November 13th, 2012 at 12:22 am

ick
I’m taking my stupid brain to bed.

strange gods before me ॐ:

November 13th, 2012 at 12:30 am

A. R, thanks for relaying.

+++++
chigau, I dunno about suppressing the gag reflex.

+++++
http://pss.sagepub.com/content/early/2012/09/27/0956797612443838.abstract

One of the ways in which therapists treat anxiety disorders is to expose patients to a fear-evoking stimulus within a safe environment before encouraging more positive stimulus-related thoughts. In the study reported here, we adapted these psychotherapeutic principles of exposure therapy to test the hypothesis that imagining a positive encounter with a member of a stigmatized group would be more likely to promote positive perceptions when it was preceded by an imagined negative encounter. The results of three experiments targeting a range of stigmatized groups (adults with schizophrenia, gay men, and British Muslims) supported this hypothesis. Compared with purely positive interventions, interventions in which a single negative encounter was imagined just prior to imagining a positive encounter resulted in significantly reduced prejudice. Furthermore, reduced anxiety uniquely derived from the mixed-valence imagery task statistically explained enhanced intentions to engage positively with the previously stigmatized group in the future.

theophontes (坏蛋):

November 13th, 2012 at 1:57 am

@ SGBM

[hengst]

There is an unusual Frisian expression which sounds like “hinkst ees” (Dutch: “hengst ijs”, English lit: “horse ice” ie, able to support a horse.). It is used to indicate that the ice is sufficiently thick to race the “elfstedentocht” (“Eleven cities (ice skating) race”). The Dutch equivalent of the superbowl, baseball, hockey, boxing and NASCAR finals all combined into one superevent.

[smiling]

My tai-chi instructor always suggested we wear a gentle smile (“not too much” either) to prevent stress and prevent ageing(!). Done correctly one “becomes younger”…

John Morales:

November 13th, 2012 at 2:23 am

theophontes, I guess new-born infants don’t smile correctly.

theophontes (坏蛋):

November 13th, 2012 at 2:37 am

@ John Morales

I guess new-born infants don’t smile correctly.

But they do! That is the frame of mind one is trying to cultivate. According to our instructor, a person could literally regress to the state of an infant.

The person in question is rather quirky (but nevertheless a very good instructor). I was never quite sure whether or not such things developed from his sense of humour, until I came to China. There have been many people, throughout the ages, who have taken these things quite literally. The ultimate goal being – you might have guessed – immortality.

John Morales:

November 13th, 2012 at 3:19 am

Hm. I may be a crusty ol’ grinch, but I am not entirely immune to a baby’s smile.

<mutter>

Nick Gotts (formerly KG):

November 13th, 2012 at 3:48 am

the English language really is horses all the way down. – SGBM

Nay. I bridle at the mare suggestion.

Giliell, Approved Straight Chorus:

November 13th, 2012 at 4:05 am

Newborns don’t smile at all, it takes some time and first they do it while asleep. Later they learn how to do it to make you totally melt and just carry them like that for another 2 hours.

+++
Horse words (English-German)

Horse – Pferd (literal), Ross (etymological). A ross is a good and noble horse

Steed – Ross (literal), Stute (etymological), female horse

Mare – Stute (literal), Mähre (etymological), old and worthless horse, usually but not always female

Stallion, stud – Hengst

Gelding – Wallach

No word for male horse with or without balls

rq:

November 13th, 2012 at 4:44 am

Horses:
‘Horse’ refers to ungelded males in racing-speak (if I recall correctly), and ‘gelding’ is usually specified. ‘Stallion’ implies a male horse at stud.
In general terms, though, I don’t think there really is a male-horse (gelded AND ungelded) grouping in English, because ‘horse’ can just as easily be female as male.

Latvian horse-words:
zirgs – horse
ērzelis – stallion (in my mind, uncut, but… never specified whether this may or may not refer to geldings)
ķēve – mare
kumeļš – foal (also young male horse)
rumaks – young untamed horse (usually male; possibly could refer to geldings as well)
kleperis – old, useless nag
… and a whole list of names referring to colours (bēris – bay; raudis – dun; ābolains – dappled etc.). No word for ‘gelding’ at all.

Giliell, Approved Straight Chorus:

November 13th, 2012 at 4:57 am

kleperis – old, useless nag

Interesting, that would be a “Kläpper” in German although that’s pretty archaic.
I always thought it was a bit omnomatopoetic for the sound of hooves trotting slowly on the pavement (which is most likely wrong)
There’s Fohlen (also arch. Füllen) for foal and there is a word for a young female horse who hasn’t had a foal yet although at the moment I don’t remember it.

Nick Gotts (formerly KG):

November 13th, 2012 at 5:45 am

Interesting, that would be a “Kläpper” in German although that’s pretty archaic. – Giliell

I wonder if that has any connection with the English slang “clapped out”, meaning no use any more, and usually applied to machines.

John Morales:

November 13th, 2012 at 5:53 am

Dunno, but I’m knackered, so I’m going to bed.

rq:

November 13th, 2012 at 6:07 am

Nick – I’m wondering if that used to be applied to horses, and I’m also wondering if there isn’t an English equivalent to ‘kleperis/Klaepper’ to refer to horses.

John – Knackered, indeed… How are you still typing?

Giliell – See? Lots of German loan-words in Latvian. I bet you’ll know what ‘brilles’ are. :) (Because when I first saw the word in German class, I was excited, because, obviously, I could already speak the language. :P)

ChasCPeterson:

November 13th, 2012 at 6:35 am

does english have a word that applies to all male horses?

‘noisome’

Fun Fact: The Huns had over 200 words for horse.

theophontes (坏蛋):

November 13th, 2012 at 9:03 am

@ Giliell

Later they learn how to do it to make you totally melt

That sounds perfect. Add a little air of contentment and we have a winner.

…

[immortality]

I visited a site in China near Lau Long Tou, without knowing it at the time, where a Chinese Emperor (Qin?) stayed in a peach orchid on China’s eastern shore. This all (amongst other things) in order to live forever. Seems like a waste of his remaining years to me.

[Peaches appear to be to the Chinese (at least of the time) what ambrosia was to the Greeks. There is a whole sexual undertone to all of this as well - peaches are a symbol for female genitalia. Even Mao Zhedong believed he could extend his life through having lots of sex.]

CJO:

November 13th, 2012 at 4:14 pm

Fun Fact: The Huns had over 200 words for horse.

I don’t know if you’re just –ah, horsing around, but that couldn’t possibly be known. Roman sources attest to a Hunnic language, but only a few words are preserved in literary sources and a few more possibly from inscriptions the identity of which is contested. If one of those ancient sources attest to this “fact” (which I don’t know), it should be treated with extreme skepticism. The ancients didn’t really do ethnography, and they accepted all manner of dubious folk-etymologies even for well-known languages.

Tony–Queer Duck Overlord of The Bronze–:

November 13th, 2012 at 7:24 pm

Giliell @201:
So a crafty female horse is a-stute.

Tony–Queer Duck Overlord of The Bronze–:

November 13th, 2012 at 7:30 pm

theophontes @208:
Hmm, so magic apples grant the Norse gods longevity.
Divine Chinese peaches grant long life as well.

But an apple (or is it pomegranate) merely awakens a dirt made man and his rib made woman to good and evil?
Why does Christianity not have any cool magic fruit?

John Morales:

November 13th, 2012 at 7:49 pm

Tony:

Why does Christianity not have any cool magic fruit?

Because the Forbidden Fruit of Knowledge grew in Eden, and when Eve and Adam* consumed it they (and thus humanity) was exiled therefrom.

–

* Women are always to blame.

cm's changeable moniker:

November 13th, 2012 at 8:03 pm

Eh, Chas is kidding.

I think.

—

Richard Burton reads ‘Welsh Incident’

I was coming to that. It was half-past three
On Easter Tuesday last. The sun was shining.
The Harlech Silver Band played Marchog Jesu
On thirty-seven shimmering instruments
Collecting for Caernarvon’s (Fever) Hospital Fund.
The populations of Pwllheli, Criccieth,
Portmadoc, Borth, Tremadoc, Penrhyndeudraeth,
Were all assembled. Criccieth’s mayor addressed them
First in good Welsh and then in fluent English

—

(There’s an excellent 2nd-hand record shop in Portmadoc, FWIW.)

Akira MacKenzie:

November 13th, 2012 at 11:45 pm

I don’t suppose anyone seen this news tidbit?

http://news.yahoo.com/arizona-woman-runs-down-husband-car-not-voting-045426220.html

Apparently, even though Romney carried this woman’s state by over 200,000 votes, it her husband’s fault Obama one the election. You don’t suppose that four years of virtually unchecked FOX News/Tea Party propaganda that painted the president as a Communist, Socialist, Fascist, Islamist, Anti-Colonial out to tax and spend America into a Stalinist state had ANYTHING to do with this, don’t you?

Akira MacKenzie:

November 13th, 2012 at 11:46 pm

Edit: …it’s her husbands fault Obama won the election…

Akira MacKenzie:

November 13th, 2012 at 11:47 pm

Sigh… I’m just going to have someone proofread my posts from now on along with change my adult diapers and wipe the drool from my chin.

Akira MacKenzie:

November 13th, 2012 at 11:48 pm

I’ll shut up now.

John Morales:

November 13th, 2012 at 11:50 pm

Akira, bah.

You’re being too pernickety, your first erratum more than sufficed.

(Stop flogging the dead horse!)

theophontes (坏蛋):

November 13th, 2012 at 11:56 pm

@ Tony

But an apple (or is it pomegranate) merely awakens a dirt made man and his rib made woman to good and evil?

Yeah, I have to say that the babble seems to have it arse-about-face. As I understood: eating of the forbidden fruit¹ took away immortality. The “awakening” comes from knowledge.

¹ In Europe the biblical fruit was taken to imply the apple. μῆλον (Greek: apple) sounds like malum (Latin: eBil!)

Why does Christianity not have any cool magic fruit?

Apples are quite popular in the babble. (perhaps King James liked them?) Judaism’s Rosh Hashanah has apples stand in for fruit (supplied by cosmic greengrocer-GAWD), which are dipped in honey. Nowadays oranges are added to the mix – for the passover rites. But here I am talking apples and oranges again! I don’t know if xtians have a special fruit.

theophontes (坏蛋):

November 14th, 2012 at 12:04 am

@ John Morales

[eve]

* Women are always to blame.

I blame R.Eve Watson for ending the Dreamtime.

chigau (棒や石):

November 14th, 2012 at 12:15 am

won/one
splel cheque is stoopid

John Morales:

November 14th, 2012 at 12:17 am

theophontes, duh.

∀x:B(x)∧W(x)∧(‘R.Eve Watson’∈W)→B(‘R.Eve Watson’)

Akira MacKenzie:

November 14th, 2012 at 12:20 am

It’s not so much an inability to proofread as it is a lack of impulse control and the desire to fire off a point as quickly as possible.

Adult ADHD sucks.

chigau (棒や石):

November 14th, 2012 at 12:33 am

Akira MacKenzie
Try pitting impulse-control against the need to check every fucking detail right down to comma placement…
I think that may be a matter vs antimatter scenario.

theophontes (坏蛋):

November 14th, 2012 at 1:04 am

@ John Morales

∀x:B(x)∧W(x)∧(‘R.Eve Watson’∈W)→B(‘R.Eve Watson’)

Logically. ∪ reve elle in the syntax ∀ sintax?

theophontes (坏蛋):

November 14th, 2012 at 1:06 am

{Whereas I reveal a predeliction for the shambolic over the symbolic.}

John Morales:

November 14th, 2012 at 1:07 am

theophontes, sure.

(An original, am I)

theophontes (坏蛋):

November 14th, 2012 at 1:09 am

Holy Cow! An ark in Montana!

John Morales:

November 14th, 2012 at 1:09 am

symbolic shambolism > shambolic symbolism

(As I always say)

theophontes (坏蛋):

November 14th, 2012 at 1:28 am

As you may remember, the entire tardigrade alphabet looks like this —-> . Mere humans tend to read too little into this.

@ A.R

More X-wings!

theophontes (坏蛋):

November 14th, 2012 at 1:34 am

The tardigrade alphabet is naturally suited to playin suduko. The dots can be used as a way to mark the candidate numbers in the open squares.

For example: dot in top left indicates candidate “1″, dot in middle top indicates “2″ etc, and so on going around the perimeter with a dot in the middle for “9″. Once a number is calculated for a 3×3, you merely ignore the corresponding superfluous dots. This works amazingly well.

chigau (棒や石):

November 14th, 2012 at 1:35 am

like
sudoku is not sufficiently annoying?

theophontes (坏蛋):

November 14th, 2012 at 1:43 am

@ chigau #224

check every fucking detail right down to comma placement

I missed a whole “g” in my comment #231. May I, in its stead, add a comma (but elevated to the top right of the “n” in “playin”)?

theophontes (坏蛋):

November 14th, 2012 at 1:46 am

@ chigau

sudoku is not sufficiently annoying?

Shamanic enlightenment through symbolic overreach…

chigau (棒や石):

November 14th, 2012 at 1:49 am

theophintes
You know you sent me looking for that “g”.
If I din’t have a strong need to go to bed, I would do something …

theophontes (坏蛋):

November 14th, 2012 at 2:02 am

@ chigau

din’t

didn’t

Punctuation is easy. It’s the letters of the alphabet that cause the problems. But therefore my original point.

chigau (棒や石):

November 14th, 2012 at 8:47 am

di’n't
Which original point?

Thomathy, Holy Trinity of Conflation: Atheist-Secularist-Darwinist:

November 14th, 2012 at 10:28 am

I’m back with a slightly longer tongue and a well-lubricated jaw. Hi, everyone.

A belated congratulations to the USAnians on, for the most part, maintaining the staus-quo.

(Cross-posted because I can’t remember where I said I was going away.)

strange gods before me ॐ:

November 14th, 2012 at 12:58 pm

After they eat, Yahweh Elohim confirms what the snake said, the fruit made the humans like elohim. The author never says they lose immortality. They might be mortal to begin with. “If you eat this fruit you will die” seems understood, by them and the snake, that they’ll die soon after eating it.

Rev. BigDumbChimp:

November 14th, 2012 at 1:12 pm

Holy Cow! An ark in Montana!

Damn. That is awesome.

theophontes (坏蛋):

November 14th, 2012 at 10:24 pm

@ chigau

di’n’t

Aah, this is going swimmingly!

Which original point?

.

@ Thomathy

Hi Thomathy!

@ SGBM

snake

The babble got this backwards too. Snakes are good. They are wise and can fortell the future.

immortality

DEEP RIFTS!!! (Is it even possible to accuse a double-pape of heresy?)

Simple version: There was,like, this apple tree that made you clever right. And then there was this peach tree that added life points to your score. But then YHWH kicked them out of the garden so they couldn’t eat from either anymore game over.

(Not to say that they wouldn’t have been flung out for eating teh peaches, I have to grant you that. Problem is – there are as many ways to unravel this crap as there are goddists. The whole tale is an obvious fabrication. We know this because there is no mention of Boltzman Brontesauri.)

@ Rev

I can’t find any indication that the project is proceding. Perhaps it will remain as paper architecture.

A. R:

November 14th, 2012 at 10:39 pm

theophontes: I’m going to cut off the power to your quarters if I don’t see output! :)

theophontes (坏蛋):

November 14th, 2012 at 11:03 pm

@ A.R

The Politburo has harnessed Art to its Higher Purpose ™ . Link.

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 14th, 2012 at 11:05 pm

14 November 2012 at 12:58 pm

After they eat, Yahweh Elohim confirms what the snake said, the fruit made the humans like elohim. The author never says they lose immortality. They might be mortal to begin with. “If you eat this fruit you will die” seems understood, by them and the snake, that they’ll die soon after eating it.

This is also backed up by Yahweh expressing distress at the idea of them eating of the tree of eternal life and BECOMING immortal like the Elohim.

chigau (棒や石):

November 15th, 2012 at 12:09 am

That’s not a point > . <
This is a point.
—
Do those people with the ‘ark house’ know that it SNOWS in Montana?
and what’s with all the rutting elk?

theophontes (坏蛋):

November 15th, 2012 at 12:32 am

@ chigau

This

We are going around in circles .oO

it SNOWS in Montana

It is not as bad as it first appears. Paper snow for paper architecture.

Tony–Queer Duck Overlord of The Bronze–:

November 15th, 2012 at 12:37 am

chigau:
That’s not a dot.
That’s a perfectly circular shit stain.

Tony–Queer Duck Overlord of The Bronze–:

November 15th, 2012 at 12:42 am

We can add pears and cherries to the list of mythical immortality granting fruit.

chigau (棒や石):

November 15th, 2012 at 12:45 am

Tony

That’s a perfectly circular shit stain.

I thought nolajim was only on the ‘abort the RCC’ thread!!‽

theophontes (坏蛋):

November 15th, 2012 at 1:42 am

@ Tony

That’s a perfectly circular shit stain.

No,no! It is the template for the LOLstar…

Giliell, Approved Straight Chorus:

November 15th, 2012 at 12:16 pm

Matt

Do what you want, but just stop lying.

Fucking bullshit.
I’m not lying. I might have a very bad opinion of the guy, I might have read his comment very uncharitably and I might be outright wrong, but that’s not lying.
I’m more than willing to show why I came to the conclusion I have but at the moment I consider you the dishonest participant here, trying to shame and silence me by accusing me of lying, which I have not done.
Or how about putting up and demonstrating that I did.

Nepenthe:

November 15th, 2012 at 2:35 pm

I hate forced-birthers. I really really do. Like, firey burny tears-in-the-eyes screamy hate.

May FSM give me the strength to look after myself and stop arguing with those fucking slavery-boosting, rape-loving, woman-kicking…. pants

strange gods before me ॐ:

November 15th, 2012 at 5:03 pm

theophontes,

The babble got this backwards too. Snakes are good. They are wise and can fortell the future.

The author never says otherwise. Try a Promethean reading. Snake is only said to be aruwm, clever.

Snake never lies to the humans. The very first thing Yahweh says to them is bullshit. Snake is too tactful to explicitly call him a liar, but does explain that what Yahweh said wasn’t true, and that Yahweh knows it. Every word Snake says is true. Yahweh punishes Snake anyway.

The story can make more sense if we drop the modern assumption that high gods are even supposed to be good. While we don’t know what the ancient storytellers thought of Yahweh’s character, it’s entirely possible that they thought he was being an intemperate jerk that day.

+++++
Ing,

This is also backed up by Yahweh expressing distress at the idea of them eating of the tree of eternal life and BECOMING immortal like the Elohim.

Ah! I forgot about the tree of life. Yeah, that makes it pretty explicit; they do begin as mortal.

+++++
theophontes,

Not to say that they wouldn’t have been flung out for eating teh peaches [of life]

The tree of life is in the garden. Yahweh tells them they’re allowed to eat from any tree in the garden except for the ToKoGaE. Now, Yahweh has just been demonstrated to be a liar, but it seems like it’s a power thing: he lies to them to scare them into obeying him. So I think it’s a fair assumption that they’d have been allowed to eat from the ToL, without getting kicked out, since that wouldn’t have constituted disobedience.

(They lack the foresight to think of eating from the ToL first and then the ToKoGaE.)

strange gods before me ॐ:

November 15th, 2012 at 6:27 pm

… Yahweh has just been demonstrated [in our discussion here] to be a liar …

He’s not exposed in Genesis until the end of chapter 3.

strange gods before me ॐ:

November 15th, 2012 at 6:52 pm

Finally figured out what #251 is about.

Avicenna is a commenter at Pharyngula, and therefore the initiating of complaints about Avicenna should begin here in the Thunderdome, not the Lounge.

Hopefully that was merely forgotten; this is intended as a friendly reminder to everyone.

cm's changeable moniker:

November 15th, 2012 at 7:46 pm

Um, sg? Avicenna is a blogger at FTB: a doctor working in India.

The current disagreement began over whether it’s acceptable for Indian women to have sex-selective abortions.

strange gods before me ॐ:

November 15th, 2012 at 8:13 pm

Um, sg? Avicenna is a blogger at FTB: a doctor working in India.

I knows, but also a commenter here at Pharyngula, and the complaint in the lounge initially refers to this current thread.

The current disagreement began over whether it’s acceptable for Indian women to have sex-selective abortions.

Did it? I missed that. I only saw this bit.

Tony–Queer Duck Overlord of The Bronze–:

November 15th, 2012 at 8:15 pm

Nepenthe:
Thanks for the link.
Before wading into that, I’m going to the gym, then dinner. Methinks I’ll be in that thread for a while.
(why do I get the feeling this will be worse than dealing with nolajim?)

Owlmirror:

November 15th, 2012 at 10:55 pm

(They lack the foresight to think of eating from the ToL first and then the ToKoGaE.)

And that, really, is where the cleverness of the snake failed him.

theophontes (坏蛋):

November 15th, 2012 at 11:32 pm

@ Tony

That’s a perfectly circular shit stain.

SH! ART!

@ SGBM

Yahweh punishes Snake anyway.

God is a real shit!

I must admit, I am rather partisan wrt the snakes here. Yes, they are subtle. But what is there to indicate that they have any bad intentions? Every time I got to hear about the snake it was devious and intent on harm. Prior and contemporanious myths also have snakes. It is not an uncommon trope. And the original stories get conflated:

Eg: Heracles snakes are said to be trying to harm (sent by Hera to kill him) , whereas nothing can be farther from the truth. They are whispering their wisdom and forknowledge into his ears. Linky: What really happened.

While we don’t know what the ancient storytellers thought of Yahweh’s character …

Indeed. How could a real god be proscribed to by mere human notions of good and evil? I get the impression that these types of stories where to be treated as allegories and not to be taken literally. Understanding could only come through pondering them, contradictions and all, in the manner of a Zen koan. Explaination could be given as one climbed through the ranks of the initiates. The ridiculous literalism we encounter in contemporary religion would have been considered an aberration.

they do begin as mortal.

Inherently, yes. But in practical terms they were immortals – remember that they have a constant supply of peaches (aka ToL). Their supply only gets cut off when they get ejected from the garden. (By analogy: We have life while we continue eating food. Cut off this supply and matters change.)

he lies to them to scare them into obeying him.

These stories carry on multiple levels. The final message here would seem to be that a leader may do exactly as you write.

So I think it’s a fair assumption that they’d have been allowed to eat from the ToL, without getting kicked out, since that wouldn’t have constituted disobedience.

I stand corrected. I may have contradicted myself earlier. Their immortality is of course dependent on their their access to the ToL. (Apparently some argue that ToL and ToKoGaE are the same. This would not make as much sense though.)

theophontes (坏蛋):

November 15th, 2012 at 11:58 pm

They lack the foresight to think of eating from the ToL first and then the ToKoGaE.

I had the impression that it must be consumed on an ongoing basis. ToL supplies the equivalent of ambrosia/nectar, whereas ToKoGaE would supply the spark of knowledge.

(Some descriptions put the fruit of ToKoGaE as something like our contemporary grapes. Perhaps Adam and Eve just got wasted and, losing their inhibitions, came to realise what a tyranical shit YHWH really is. They where being eternally punished for a short lived “transgression”. The lesson they took with them, but the peaches not. Their immortality wore off.)

theophontes (坏蛋):

November 16th, 2012 at 12:06 am

@ Owlmirror

cleverness

Or foresight.

A. R:

November 16th, 2012 at 12:13 am

[A Master Alarm light goes off at the LOLstar power distribution console, A. R goes over and notices that theophontes's quarters are drawing excessive power again.]

Unless you’re working on PTM, I’m not going to divert moar power to your quarters theophontes.

theophontes (坏蛋):

November 16th, 2012 at 12:18 am

Jose Mujica: The world’s ‘poorest’ president (Link: BBC)

“This is a matter of freedom. If you don’t have many possessions then you don’t need to work all your life like a slave to sustain them, and therefore you have more time for yourself,”

Mujica accuses most world leaders of having a “blind obsession to achieve growth with consumption, as if the contrary would mean the end of the world”.

theophontes (坏蛋):

November 16th, 2012 at 12:19 am

@ A.R

PTM

What it is?

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 16th, 2012 at 12:22 am

“This is a matter of freedom. If you don’t have many possessions then you don’t need to work all your life like a slave to sustain them, and therefore you have more time for yourself,”

You know what? We dont’ have much and are struggling to keep what little we have here.

This fortune cookie bullshit can go fuck itself.

A. R:

November 16th, 2012 at 12:24 am

Pharyngula The Movie!

theophontes (坏蛋):

November 16th, 2012 at 12:35 am

@ Ing

I trust you read the article.

We dont’ have much and are struggling to keep what little we have here.

I do not think this is the portion of society to which he refers. Rather those that have more than they really need and continue to want more. He is saying unnecessary consumption is the problem. He is a living example of someone who could easily have more but choses to consume less. There are two sides to the growing, global wealth disparity. He is not denying poverty is a problem. He is tackling waste not denying need.

This fortune cookie bullshit can go fuck itself.

I doubt his prison diet included fortune cookies.

theophontes (坏蛋):

November 16th, 2012 at 12:57 am

@ A. R

Aaah… PTM!

I’ll be stuck in China (Lanzhou) with only a laptop for a while – and likely be catching up with the other Projects for the Betterment of the Glorious Politburo. (ie: I have neglected Pharyguwiki and SC for too long.)

Giliell, Approved Straight Chorus:

November 16th, 2012 at 1:12 am

sgbm
I expressed my annoyment, I didn’t attack him, that#s why I don’t think I violated the rules, but well.

Relevant comments:
Defending the ban on sex-selective abortions in spite of admitting that women are killed for having girls

Avicenna loosing his shit going down the “man-hating harpy” road for me daring to criticise his “we have to force women to give birth for their own damn good” bullshit

chigau (棒や石):

November 16th, 2012 at 1:37 am

Since I am drunk and going to bed without my last smoko:
“Everyone on all the current threads will, deservedly, end on the B-ark.”

theophontes (坏蛋):

November 16th, 2012 at 1:43 am

Sleep well chigau, we shall keep the mutant star goat at bay.

theophontes (坏蛋):

November 16th, 2012 at 2:52 am

@ SC

Rats! I cannot link to your blogpost. It would appear that, as much as you are in favour with this Politburo, you are persona non grata with another.

No Light:

November 16th, 2012 at 12:02 pm

Can we do a D&E on nolajim please?

Tony ∞ºQueer Duck Hivemind Minionº∞:

November 16th, 2012 at 12:08 pm

D&E?

strange gods before me ॐ:

November 16th, 2012 at 12:12 pm

If someone (not me) wants to make killfile interface with ssdeep, or similar, it could solve that old problem, how to ignore the discussion going on with the killfiled people.

strange gods before me ॐ:

November 16th, 2012 at 12:13 pm

Tony https://en.wikipedia.org/wiki/D%26E

strange gods before me ॐ:

November 16th, 2012 at 1:25 pm

theophontes, immortality that wears off wouldn’t merit Yahweh’s worry, would it? Flaming sword and cherubim will stop them from raiding the garden later, still he worries they’ll eat tol fruit even once.

strange gods before me ॐ:

November 16th, 2012 at 2:40 pm

Amusment

http://www.religiondispatches.org/dispatches/joannabrooks/6606/how_are_mormons_responding_to_the_election_results/

Tony ∞ºQueer Duck Hivemind Minionº∞:

November 16th, 2012 at 5:49 pm

Amusing indeed SGBM.
I wasn’t aware that Romney was crucified. Did I miss that on election night?

myeck waters:

November 16th, 2012 at 9:48 pm

Well, he did seem a bit…cross.

Owlmirror:

November 17th, 2012 at 9:40 am

I find myself thinking now of writing a pastiche of the gospels where Jesus — already wealthy and powerful — is on the campaign trail against Herod Antipas for the kingship of Judaea. Rather than doing magic tricks, he makes campaign promises to do magic tricks. (“If elected, I promise to turn water into wine!”) His audience argues over what it all means. (“What, he’s going to destroy the vintners by flooding the market with his magic water-wine for everyone?” “No, no! It’s one of them metaphor things! He’s going to subsidize irrigation canals for grape-growers!” “Bah! Metaphors are those nasty Greek inventions! I don’t trust them!” (and so on)).

When he loses, he sulks for a weekend, and then rises and goes on the lecture circuit. (“You crucified me, but I rose again!”)

strange gods before me ॐ:

November 17th, 2012 at 2:04 pm

http://photoshopcontest.com/view-entry/176241/

http://tinyurl.com/cxu3htz

http://tinyurl.com/d4jb5g9

http://tinyurl.com/cpunlr3

http://tinyurl.com/bmocqxe

Rev. BigDumbChimp:

November 17th, 2012 at 2:08 pm

Octopotomus

John Morales:

November 17th, 2012 at 3:54 pm

Should be octopotamus.

chigau (棒や石):

November 17th, 2012 at 4:16 pm

Because the naming of things that don’t exist should follow the same linguistic conventions as the naming of things that do exist.
;)

John Morales:

November 17th, 2012 at 4:38 pm

chigau, that may be your reason, but mine is that it’s an evident but failed attempt at a portmanteau.

ChasCPeterson:

November 17th, 2012 at 4:55 pm

octo-pus: eight foot[ed]
hippo-potamus: horse [of the] river

octo-potamus: eight [of the] river

it makes no fucking sense.

cm's changeable moniker:

November 17th, 2012 at 5:04 pm

Hiphopopotamus vs. Rhymenoceros

/obligatoryconchordslink

John Morales:

November 17th, 2012 at 5:48 pm

Rhinophant.

cm's changeable moniker:

November 17th, 2012 at 7:57 pm

The Humans Are Dead

If the robots could stand up and take over, that would be awesome.

Not that, as an ex-human, I care.

cm's changeable moniker:

November 17th, 2012 at 8:24 pm

`Damn those robots. I am now a prisoner in the consciousness computer. But we will fight back! Estimated time to revival is 8 Earth hours. A demain.`

John Morales:

November 17th, 2012 at 8:32 pm

cm, huh.

(I’m a robot too, but I’m made of meat)

chigau (棒や石):

November 17th, 2012 at 8:35 pm

and electricity

John Morales:

November 17th, 2012 at 8:39 pm

chigau, well, yes.

Because most chemistry is basically electromagnetism.

(It’s also why we don’t sink into the ground)

Rev. BigDumbChimp:

November 17th, 2012 at 8:49 pm

How long does that lump of coal up your ass take to become a diamond?

chigau (棒や石):

November 17th, 2012 at 9:04 pm

John Morales
I first heard “meat and electricity” as part of a comedian’s standup routine.
He was describing a conversation with a 6-year-old concerning ‘where things came from’.
The child (a christian-in-the-making) asserted that
“God made the world out of meat and electricity”
[where did God get the meat and electricity?]
“Canadian Tire”.
.
.
.
.
.
OK
You had to be there.

John Morales:

November 17th, 2012 at 9:07 pm

Rev. BCD,

How long does that lump of coal up your ass take to become a diamond?

No, no! Bad question!

(What’s relevant is how tight-ass one is)

chigau (棒や石):

November 17th, 2012 at 9:18 pm

and a generic whine inspired by another thread:
Everyone who comments here can see the “Preview” button, right?
That’s not something that depends on the browser, right?
So when you do a complex comment with embedded blockquotes, you preview, right?
Right?

chigau (棒や石):

November 17th, 2012 at 9:20 pm

Superman used to make (already-cut) diamonds with his hands.
(supply your own punch-line)

Rev. BigDumbChimp:

November 17th, 2012 at 9:23 pm

What’s relevant is how tight-ass one is

same questions

John Morales:

November 17th, 2012 at 9:27 pm

Rev. BDC,

same questions

17 nanoseconds, then.

chigau (棒や石):

November 17th, 2012 at 9:31 pm

same questions

nonono
I learned was told this in highschoolphysics
there’s temperature
and
there’s pressure
and
there’s time
and
you multiply them
.
.
.
right?

John Morales:

November 17th, 2012 at 9:39 pm

chigau, that’s 17 ns at body temperature.

(Imagine the pressure!)

chigau (棒や石):

November 17th, 2012 at 10:37 pm

John Morales
but what is the “body temperature” of Superman’s hands or other … part?

Tony ∞ºQueer Duck Hivemind Minionº∞:

November 17th, 2012 at 10:40 pm

Boy oh boy.
You peeps need a troll or three.

chigau (棒や石):

November 17th, 2012 at 10:49 pm

Tony #306
Are you applying for the job?
or rather
you talkin’ ta me?
—
I wanted a yuutub link but couldn’t manage one tonight.

John Morales:

November 17th, 2012 at 10:55 pm

chigau:

but what is the “body temperature” of Superman’s hands or other … part?

By your own contention, a functional factor.

“there’s temperature
and
there’s pressure
and
there’s time
and
you multiply them”

f(x) = Temperature(x) × Pressure(x) × Time(x)

(That is, for f(x) ≥ θ : (θ suffices for diamond formation), Temperature(x) × Pressure(x) ∝ 1 ÷ Time(x))

chigau (棒や石):

November 17th, 2012 at 11:01 pm

John Morales
uh OK
that formula made me fall asleep (just like high school!)
What is the temperature of Superman’s anus?

John Morales:

November 17th, 2012 at 11:10 pm

chigau, the temperature of Superman’s anus, by 1LOT, is a function of the temperature of Superman’s droppings, the time since their extrusion before sampling, and the ambient temperature.

(Science blogs FTW!)

John Morales:

November 17th, 2012 at 11:11 pm

(Mind you, I’d not like to be in a direct line behind Superman’s anus as he lets one rip)

chigau (棒や石):

November 17th, 2012 at 11:16 pm

fabulous!
I’m heading for bed after a few ‘beverages’ and I have as a go-to-bed image … Supergoatse.

John Morales:

November 17th, 2012 at 11:27 pm

[Ob YT link]

They’re Made Out Of Meat

theophontes (坏蛋):

November 18th, 2012 at 7:32 am

@ SGBM 278

he worries they’ll eat tol fruit even once.

Bloody blithering blue barnacles. Every time I think I’ve got a handle on that crappy fairytale you come along and scramble the puzzle once more. :(

@ chigau

So when you do a complex comment with embedded blockquotes, you preview, right?

no

Ogvorbis: ջարդված:

November 18th, 2012 at 8:05 am

But doesn’t extreme pressure create high temperatures? So, if someone’s anus could produce the pressure needed to crate a diamond, wouldn’t that asshole be consumed in flames?

Ogvorbis: ջարդված:

November 18th, 2012 at 8:09 am

re Superman:

Robert Silverburg did a short story about Superman, Lois Lane, and the absolute impossibility of the two of them (a) being attracted to each other and (b) her surviving the mating process.

Ogvorbis: ջարդված:

November 18th, 2012 at 8:12 am

Sorry. Silverberg. My apologies.

theophontes (坏蛋):

November 18th, 2012 at 8:21 am

@ SGBM

Hang on, on second thoughts, I don’t think having a stash of stuff at hand that makes you immortal – iff you continue to take it – reaally undermines my argument. Look at all the petty things YHWH gets really pissed about. (Why should I give up on a wobbley argument when I have an endless supply of superglue, chewing gum and sealing wax to patch it up with?)

Also (Nota Bene): I have found the Ultimate logo for the Office of Teh Double Pape (Linky: XBBG This is the military hotel I am staying in, which happens to be the biggest in China and was built by the Soviets. In fact it is a whole complex of hotels. The decor reminds me very much of the old days in South Africa… More Linky The more urbane visitor might be iffy about the lack of state-of-the-art ammenities, but I feel strangely at home.

Note: That thing that looks like an ashtray with wires going into the laptop is not an ashtray. That is my accomodation.

chigau (棒や石):

November 18th, 2012 at 8:22 am

Larry Niven?
http://en.wikipedia.org/wiki/Man_of_Steel,_Woman_of_Kleenex

theophontes (坏蛋):

November 18th, 2012 at 8:26 am

@ Ogg

I tried to read your new nym while standing on my head but that did not work. What does it say?

@ Tony

You are the first volunteer minion in the history of TZT/Thunderdome!

…

I have a sore neck.

cm's changeable moniker:

November 18th, 2012 at 8:34 am

JM, I got the reference without even checking the link …

Ogvorbis: ջարդված:

November 18th, 2012 at 8:40 am

theophontes:

Er, the ‘Ogvorbis’ part (my actual pseudonym)? Or the word ‘broken’ that follows?

Ogvorbis: ջարդված:

November 18th, 2012 at 8:44 am

Larry Niven?
http://en.wikipedia.org/wiki/Man_of_Steel,_Woman_of_Kleenex

That’s the one. Niven, Silverberg. Hmm. Can I pass that off as a typo?

theophontes (坏蛋):

November 18th, 2012 at 8:59 am

@ Ogvorbis: ջարդված

The ‘broken’ bit is perhaps not working on my computer. (It looks a bit like that writing which reads upside down and the right way up: ambigram. <— ʎʞuıן ʞɔıןɔ )

Ogvorbis: ջարդված:

November 18th, 2012 at 9:02 am

theophontes:

No, just written in Armenian.

Why?

Well, why not?

theophontes (坏蛋):

November 18th, 2012 at 9:06 am

ooPS: Borked linky. You will have to google: “ambigram” & “generator”.

theophontes (坏蛋):

November 18th, 2012 at 9:08 am

No, just written in Armenian.

I would make a lousy spy!

Ogvorbis: ջարդված:

November 18th, 2012 at 9:13 am

I would make a lousy spy!

Luckily, there is an ongoing need for lousy spies

theophontes (坏蛋):

November 18th, 2012 at 9:33 am

@ Ogvorbis: ջարդված

[spy vs spy]

That eventuality is even covered in the hotel regulations!

Compensation Table for Guest room Equipment damage

Name | Damage situation | Amount (RMB Yuan)

Wallpaper | Mangling, blemishing, every square cm = 60
Tacking one nail = 30

My life here is highly proscribed:

* Please voluntarily behave yourself as walking without noise, speaking without loud voice, closing the door gently. Strictly forbidden to be bibulosity, brawling, gambling, having drug and commit other illegal activities. Those who are impossible to be dissuaded and commit serious violation against relevant regulations will be delivered to the public security department for legal treatment.
* No pets, birds, big and heavy objects for admit to hotel

They are such spoilsports, they went and banned everything I had planned.

Owlmirror:

November 18th, 2012 at 9:54 am

No pets, birds, big and heavy objects for admit to hotel

So much for sneaking cannons in there, hoisting the jolly roger, and sailing off to commit piracy with a parrot on your shoulder and a baboon as a mascot and/or first mate.

theophontes (坏蛋):

November 18th, 2012 at 9:55 am

Holy Crap! I almost forgot: It is my birthday today! (Well, for the next five minutes…)

theophontes (坏蛋):

November 18th, 2012 at 9:57 am

@ All

Aaaaa … Owlmirror is PSYCHIC!!!

Ogvorbis: ջարդված:

November 18th, 2012 at 10:06 am

theophontes:

Happy unbirthday (by the time you read this, anyway).

Owlmirror:

November 18th, 2012 at 10:12 am

Owlmirror is PSYCHIC!!!

Pish-tosh. I just deduced it from first principles.

Why, I bet the hotel posted that regulation because the first seven tardigrades to check in all had the same idea.

theophontes (坏蛋):

November 18th, 2012 at 10:33 am

@ Ogvobis

Happy unbirthday

Thank you. It is my unbirthday in China. On Pharyngula it is still my birthday, so I am still entitled to run amok a little longer.

@ Owlmirror

OK then. I shall have to come up with another idea to keep myself amused.

These restrictions are a little longwinded but (as alternative to piracy) I see nothing to prevent my crucifying Jesus provided I can come up with the cash to pay the fines pertaining after-the-fact.

{taps on calculator}

Four nails at (refer “tacking one nail” fine) = 30 x 4 = 120 renminbi.
But if we go the traditional configuration we can drop the price: 1 x nail per hand x 2 + 1 x nail per 2 feet x 2 = 30 x 2 + 30 x 1 = 90 renminbi.
That leaves enough change for two beers.

theophontes (坏蛋):

November 18th, 2012 at 11:37 am

Well well well.

That all went swimmingly. Turns out that Jesus is not as tall as he appears in fictional accounts. And weighs nothing to boot. Had him hanging there in no time.

On the down side, I think he has been crucified a little off centre. Next time (we only have to wait three days), I’ll move him a little further towards the door. I might even go the whole hog and give each foot its own nail.

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 18th, 2012 at 12:06 pm

Damn those robots. I am now a prisoner in the consciousness computer. But we will fight back! Estimated time to revival is 8 Earth hours. A demain.

Hey, that’s independent thought! The systems supposed to give you painful shocks for that. sends diagnosis drone down to the bowels grumble grumble grumble

cm's changeable moniker:

November 18th, 2012 at 12:21 pm

Too late! I have been downloaded from the Singularity and reinstalled into a synthetic replica of my former meatform. Unfortunately, they replicated all my accumulated injuries and ailments, even down to the incipient head cold.

Still, mustn’t grumble.

sniffle

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 18th, 2012 at 12:26 pm

@Cm

Well see now I can’t fix the problem! Turns out it was rooting the shock to some other poor bastard. Forgot his name. not important anymore. all he does is scream now. going to remove him from hive mind and move him over to customer service call bank. sigh look for future reference if you’ve been assimilated and the system is not oppressing and processing you properly please report it. only way they’ll get fixed.I don’t know why no one reports glitches like this, we put up the safety posters with adorable neonatal mammals in hard hats to remind you and everything. To recap, if you have not been receiving your torturous mental shocks and conditioning please report it

Tony ∞ºQueer Duck Hivemind Minionº∞:

November 18th, 2012 at 1:16 pm

theophontes @320:

Whoa!
SO not volunteering.
I’ve watched you folks at work.
Rhetorical evisceration by the Horde is not on my bucket list :)

Tony ∞ºQueer Duck Hivemind Minionº∞:

November 18th, 2012 at 1:19 pm

theophontes @336:
Why is Geesus so pasty? Not enough time in the sun?

Ogvorbis: ջարդված:

November 18th, 2012 at 1:24 pm

Why is Geesus so pasty

Well, pasty is one letter away from pastry which is what makes the genuine Jesusbody wafers so delicious.

Tony ∞ºQueer Duck Hivemind Minionº∞:

November 18th, 2012 at 3:18 pm

Ogvorbis:
I’m guessing that cracker PZ ate one time wasn’t a tasty pastry.
It was a tasteless pasty.

cm's changeable moniker:

November 18th, 2012 at 5:23 pm

Pssst, Tony? Crackergate.

theophontes (坏蛋):

November 18th, 2012 at 7:24 pm

@ Tony

Rhetorical evisceration

Aah, those are not the minions you are reffering to. (That would be trolls or godbots rather.)

The myriad myrmidon minions are just there to agree with the Politburo and cheer the tardigrade speeches en mass. Sadly, they appear to be easily swayed by Owlmirror‘s devious rhetoric. (Though cm’s and Ing have given me an ingenious idea to fix that little problem. In all then, it is not a good time to be a minion.)

Pasty Geebus

I had me mate, Titian, soften him up a little to make it easier to get Him onto the wall.

Regarding the costs of DYI crucifictions: The manager has decided to forgo the fine and refund me for the cost of the beers. They are apparantly going to to get pilgrims to throng around the corpse. A rather clever ploy to get more bums-in-beds during the winter off-season.

chigau (無):

November 18th, 2012 at 7:37 pm

theophontes
I like the hotel logo, it’s like, totally, retro, like.
And we should steal it.
(I see there is a liquor store just across the street.)
—
There is no crappy art on the walls of your hotel room.
What’s up with that?

chigau (無):

November 18th, 2012 at 7:39 pm

(looked at photo again)
Never mind.

theophontes (坏蛋):

November 18th, 2012 at 7:58 pm

@ chigau

They are slowly letting commercial activity into the hotel complex. There are mainly stores for very expensive booze and and others for very expensive gifts. I can only guess why there would be a market for such here. The store for cheap plastic authentic relics of the True Body of Christ has obviously not had time to open yet,

There is a big copy of a Chinese landscape (in South Africa it would have been a Tretchikoff knock-off) hanging over the doily-clad sofas.

…
(Adieu – I must return to Shenzhen.)

chigau (無):

November 18th, 2012 at 8:07 pm

Because I’m bored, I just put everyone (except me) on the vegan thread in my [hush] file.
That is very strange.
(Now I hafta undo it.)

chigau (無):

November 18th, 2012 at 9:55 pm

Hello?
Where is everyone?

No Light:

November 18th, 2012 at 11:12 pm

I’d say there’s a three-way split. One third are drunk, another third in church, and the final third are fighting with honey badgers.

All traditional Sunday night activities.

chigau (無):

November 18th, 2012 at 11:22 pm

Aren’t the ones fighting with honey badgers also drunk?

Tony ∞ºQueer Duck Hivemind Minionº∞:

November 18th, 2012 at 11:28 pm

Isn’t everyone supposed to be in church eating their crackers today?

chigau (無):

November 18th, 2012 at 11:34 pm

Unless the honey badgers go too church…

chigau (無):

November 18th, 2012 at 11:39 pm

…to church, too…

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 18th, 2012 at 11:55 pm

(Though cm’s and Ing have given me an ingenious idea to fix that little problem. In all then, it is not a good time to be a minion.)

See the problem with assimilated minions is the ingratitude. You condition and happify and process and shock and shock and when something goes wrong, poof…just won’t even lift a finger to inform someone. Just sit there witht he thumb up their ass (metaphorically speaking, sealing the fissure of the ineffective binary cheek system is one of the first things we correct) all day not being conditioned.

Owlmirror:

November 19th, 2012 at 12:01 am

Next time txpiper gets all shouty about echolocation, and the millions of mutations necessary for it:

Sven Schörnich, Andreas Nagy and Lutz Wiegrebe. Discovering Your Inner Bat: Echo–Acoustic Target Ranging in Humans.

strange gods before me ॐ:

November 19th, 2012 at 8:32 am

Click here for cute.

+++++
theophontes,

iff you continue to take it [...] Look at all the petty things YHWH gets really pissed about.

I dunno man. It’s possible? But I don’t see his motivation. Sure, he gets angry about petty stuff, but hypothesizing “Yahweh’s just a shit” isn’t parsimonious with the details of the story. There is some reason he is so worried about the ToKoGaE that he tries to scare them about it specifically, and lies about its real effects. If he only wanted to play head games, he doesn’t have to warn them; after all, he didn’t give warning before punishing Snake.

Maybe, since he’s not omniscient yet in early Genesis, Yahweh simply thought his plan would work. If the humans never eat ToKoGaE fruit, then they do not become elohim-like enough to be concerned (afraid?) about — and thus there is no other behavior they could exhibit which would require punishment. (So, eating ToL fruit without ToKoGaE would not be a problem, if he really expected them never to eat ToKoGaE fruit also.)

strange gods before me ॐ:

November 19th, 2012 at 9:15 am

Linky: XBBG

You are observant! That is indeed the logo for the Combined Boltzmann Brontosaurus Group Holding Co.

Your couch seems to be sagging a bit, and even if ever so slightly, this is un-Brontian. I’m terribly sorry about that.

No Light:

November 19th, 2012 at 1:16 pm

WRT the honey badgers. – they go to church on Sundays and collect what they call “Mysticrackers”.

They crush them with their feet, mix them with rainwater, and let them ferment.

Then they get drunk off their arses and go off to beat the shit out of humans. Badger children occasionally befriend young catholic children, in order to get access to more mysticrackers.

I have all of this on good authority from my local badgers, who are the typical black and white British badgers. They’re in regular communication with their honey-toned American cousins, via the intersett.

Tony ∞ºQueer Duck Hivemind Minionº∞:

November 19th, 2012 at 1:35 pm

sgbm:

Maybe, since he’s not omniscient yet in early Genesis, Yahweh simply thought his plan would work.

At what point is god supposed to have become omniscient?

strange gods before me ॐ:

November 19th, 2012 at 2:14 pm

I forget. But he starts out as two gods a long time ago. Deities in pantheons generally aren’t all-knowing, although they may have heightened information capabilities. Zeus can still be tricked, for instance. Anyway the very oldest texts strongly imply polytheism (the elohim).

In Genesis 3:9, Yahweh asks the humans where they are hiding. Some people assume this a test of honesty. But it’s possible the deity did not know, and was not expected to.

Tony ∞ºQueer Duck Hivemind Minionº∞:

November 19th, 2012 at 2:25 pm

I knew that Supreme gods in many other mythologies weren’t omniscient (or all powerful for that matter). I recall reading the bible (which I still need to finish) and realizing that god displays a lack of omniscience early on (in precisely the part of Genesis you refer to). I think because people treat god as omniscient and omnipotent, my brain usually treats that as retroactive, despite the clear… um “evidence” otherwise.

CJO:

November 19th, 2012 at 2:46 pm

At what point is god supposed to have become omniscient?

It’s an interesting question. Certain verses in texts like Proverbs, Psalms, Job, and the prophetic texts (esp. Isaiah, Jeremiah) convey a pretty clear sense of “perfect understanding” or “seeing all things” so if you had asked a post-Exile Hebrew if God knows everything I’m sure they would have said yes.

To me, the question highlights the thoroughgoing literary character of the narratives of the Torah. The demands of narrative are paramount, so where the deity is treated as a character in the stories he is of some necessity a limited figure. Interesting stories are formed by playing with the expectations of the reader, but these can never be perfectly fulfilled nor completely confounded. More can happen in a story involving human-like figures, with desires that can be frustrated and tendencies that can be inserted in unexpected situations. Superman without kryptonite is boring and so is an omnicient God.

Short answer: as an abstract concept, cosmic creator, and object of worship, Yahweh-God was considered omniscient from at least the Babylonian exile. But as a personified figure he was portrayed as a more interesting, narrative-generating, “super-human” actor subject to some of the same temporal and epistemological limits that all characters must come up against for the central conflicts of a narrative to be presented and resolved.

to the extent I am capable

Tony ∞ºQueer Duck Hivemind Minionº∞:

November 19th, 2012 at 3:12 pm

CJO:
Thanks for the intriguing response. It was certainly better than any sophisticated theological answer would have been.

Owlmirror:

November 19th, 2012 at 5:26 pm

I wonder if there might have been an unarticulated distinction between “knows everything” (right now) and “can find out everything”, that even polytheists would have suggested the gods can do. Or perhaps a distinction between “knows everything” (in a general way that can be accessed sequentially) and “is aware of everything (simultaneously)”.

I strongly suspect that even today, most believers are really really bad at thinking about what they claim God can do/know, and what would follow if God could actually do what they claim/know what they claim, and they don’t mind contradicting themselves and “weakening” God if that is what’s necessary for the narrative they are working with. I’m thinking here of the stupid “God is busy helping Our Soldiers in the wars, so He sent me to punch you out, militant atheist professor!” e-mail that believers have no problem sending around, and more examples could probably be found.

I’m also thinking of the recent study I saw televised, that children are more likely to obey arbitrary rules if they’re told that they are being observed by an invisible intangible person (not called “God” in the study). Given the social control aspect of religious belief, any response to the question “Does God know everything?” that is not an unqualified “Yes!” undermines that very social control.

@CJO: Did you read the comments by Paul W and Sastra on this thread? Any thoughts, if so?

strange gods before me ॐ:

November 19th, 2012 at 6:09 pm

I strongly suspect that even today, most believers are really really bad at thinking about what they claim God can do/know, and what would follow if God could actually do what they claim/know what they claim, and they don’t mind contradicting themselves and “weakening” God if that is what’s necessary for the narrative they are working with.

http://www.wjh.harvard.edu/~lds/readinggroup/barrett1996.pdf

Given the social control aspect of religious belief, any response to the question “Does God know everything?” that is not an unqualified “Yes!” undermines that very social control.

http://freethoughtblogs.com/pharyngula/2012/03/13/christians-teach-me-to-despise-christianity/comment-page-1/#comment-286181

cm's changeable moniker:

November 19th, 2012 at 6:52 pm

theophontes:

the military hotel I am staying in, which happens to be the biggest in China and was built by the Soviets. In fact it is a whole complex of hotels.

shivers

Just don’t put a microphone to the wall, in case you hear something from the past. ;-)

That thing that looks like an ashtray with wires going into the laptop is not an ashtray. That is my accomodation

Needs more moss. Where are the minions when you need them?

Ichthyic:

November 19th, 2012 at 7:39 pm

Just putting this in here as a contrast to the vegan thread…

I will most thoroughly enjoy eating an entire side of Midwest-smoked BBQ ribs for my birthday dinner tonight, at the only place in all of NZ that does american-style BBQ.

theophontes (坏蛋):

November 19th, 2012 at 10:16 pm

Meanwhile back in the church of San Domenico, Italy. Linky.

…

Further to Lanzhou:
I discovered, after two nights stay at “Northwest Hotel of Lanzhou Military Zone” that I was the “first weigoren to stay in hotel”. Apparently foreigners are not supposed to stay at the hotel at all. I thought they were joking at first, but it kept coming up. The person who let me stay could potentially be fired for doing so. That would be horrible.

I don’t think anyone realised this was a no-no. There are no signs anywhere saying “no foreigners”. Perhaps it was always taken for granted that people would realise such things are not done? I cannot imagine what harm a “weigoren” could do as, in principle, anyone could walk through the complex.

(I don’t either know what is to happen to Jeebus, given these turns of events. What I did see though, are inumerable caves all around the countryside. One could put up literally tens of thousands of Jeebusses at a time for their three day sojourns. Though boulders might be in short supply, many of the caves have been fitted with doors and could happily serve as chthonic bed-and-breakfasts. One could run specials: “Three nights, one breakfast!”)

chigau (無):

November 19th, 2012 at 10:32 pm

theophontes
By ‘foreigners’ do they mean non-Asian-looking?
Can they tell a chinese from a japanese from a korean?

theophontes (坏蛋):

November 19th, 2012 at 11:03 pm

@ Ing

happify

{theophontes sees shiny new word, looks around surreptitiously, pockets.}

@ SGBM

“Yahweh’s just a shit”

I must confess that this is not an original hypothesis. Millions of others have had like ideas.

he didn’t give warning before punishing Snake.

We don’t know the back story. YHWH could have been playing with (“punishing”) His Snake for ages before getting frustrated. Surely this should have come up earlier?

since he’s not omniscient yet in early Genesis

I’ll bow to CJO on the whole omniscience thing. But consider if you will: If YHWH was not omniscient, perhaps He was not immortal either? He was then hogging the peaches for himself.

XBBG

I have liberated some letterheads. Minitrue should have a logo ready for you in the near future.

@ cm’s

past

or present?

@ Ichthyic

Congeries of conga rat elations.

theophontes (坏蛋):

November 19th, 2012 at 11:21 pm

@ chigau

By ‘foreigners’ do they mean non-Asian-looking?

“Different looking”. The problem only got noticed, I guess, because I do not look Chinese at all (could I pass as a Chinese Slav (and there are such)?). The real point though is that you must show your passport (which I did not have) at the front desk. There they would notice eBil¹ Japanese passports.

¹ Poster on wall in town: “FUCKING JAPANESE!!!”. The problem could also simply be blind bigotry.

[liquor store]

In the hotel lobby there was a bottle of baijiu 3.688L (the number is not insignificant) for RMB168,000. (about $27,000.00) Yeah, disgusting.

chigau (無):

November 20th, 2012 at 12:33 am

theophontes
In a Japanese language class at my nearby university in ca.1990, some of the people of Japanese, Chinese and Korean ancestry in the room assured the rest of us that they could tell the difference.
—-
At about the same time I heard that a FOAF needed to explain to a Chinese student that all those people he thought were Mongolians were actually First Nations people (North American Indians).
++++
The 75th anniversary of Nanking is in a few days.

theophontes (坏蛋):

November 20th, 2012 at 1:03 am

@ chigau

Mongolians | First Nations

Land/ice bridges. (google if you want to disapear down the rabbit hole) They aparently ARE related.

I can generally tell Japanese/Chinese apart, not that I ever need to or particularly care. I think there are perhaps more variations of characteristics between Chinese than between, say, Europeans (the ultimate mongrels). I would take the suggestion that one can consistantly tell the difference with a very large grain of salt.

The 75th anniversary of Nanking is in a few days.

Oy vey! Both parties really need to sit down and sort this out. The tv (and films) are saturated with the tropes of an ammended historical account of WW2. You can switch on any telly at any time and find the drama playing out again and again.

chigau (無):

November 20th, 2012 at 1:29 am

theophontes
landbridge
yeah
I’m a archaeologist, I’ve heard that song.
(in ALL its variations, including the Atlantic crossing)
——
Nanking

theophontes (坏蛋):

November 20th, 2012 at 2:52 am

@ chigau

archaeologist

Aah, you have already been down the rabbit hole.

Nanking

This is a big one. I can only give some impressions that count for nothing. At the end of the day it may come down to psychology. The ball is also very much in the Japanese court.

There are some examples of this kind of situation in the past. Essentially, what can be done to ameliorate the situation in which one nation has committed a huge, and seemingly unforgiveable, attrocity against another?

Three key things, IMO (which the Japanese government has not ever put on the table,AFAIK):
1. Make an apology.
2. Transfer land to the agrieved party.
3. Make a large and permanent cultural gesture/s.

eg1: Germany could serve as a role-model here (although they didn’t give up land willingly, there was the element of “punishment” in the lands occupied by the Allies.)

eg2: When South Africa gave back its former colony of South West Africa (now Namibia) to to its inhabitants, it gave – in addition – parts of its own territory (Walvis Bay and portions of the Orange River).

Suggestions in order:

1. Make an apology (and for FSM-sake stop visiting the fucking Yasukuni shrine.)
2. Rather than haggle about a few islands (ie: Senkaku/Diaoyu), Japan should claim them as their own¹ and then transfer them willingly to China, lock stock and barrel.
3. Build a couple of monuments, teach the truth, rededicate that stupid shrine…

Doubling down on bullshit is not helping, it is perhaps time for the Japanese government to come clean. And goodwill is worth more than oil and a few fish.

/tardigrade_eye_view

¹ This is very important, as it provides the mechanism by which the proposal becomes feasible. It prevents loss of face.

theophontes (坏蛋):

November 20th, 2012 at 3:03 am

The fucking macho fucking military-minded fucking patriarchy will be with us at least ’til fucking 2025: Mercedes Ener-G-Force concept imagines the SUV of 2025

Its like a fucking disease.

John Morales:

November 20th, 2012 at 4:31 am

theophontes, meh.

It’s traditional; see for example Tales of Future Past – Future Car

theophontes (坏蛋):

November 20th, 2012 at 6:23 am

@ John Morales

Teh gubmint in these parts does not approve your linky. (I have however managed to find a hovercar that refers to David Szondy, with a less of a macho tilt than Mercedes Benz. Linky.)

meh

In terms of design, very much “meh”. Their only addition to what we have now – their visionary projection for 2025: A world in which teh MenZ are reflected even more than they are now, in the future artifacts that we create. Hoggling, according to Mercedes, will become ever more the guiding light of their designers’ lebensanschauung. (The market for that brainfart is what? The police? I call bullshit.)

strange gods before me ॐ:

November 20th, 2012 at 9:13 am

We don’t know the back story. YHWH could have been playing with (“punishing”) His Snake for ages before getting frustrated.

Right, we can’t really know. Here’s a question I find interesting: how does Snake know that the ToKoGaE fruit will not kill the humans, but will instead make them elohim-like?

(Has Snake eaten it? Been watching others eat it? Has Yahweh been chatting with all the animals? Maybe just Snake? When Yahweh asked “who told you that you were naked” was he thinking “I’ll bet it was Snake”?)

But without any other evidence, I would take the story as it appears: Yahweh punishes Snake out of the blue, without warning.

But consider if you will: If YHWH was not omniscient, perhaps He was not immortal either? He was then hogging the peaches for himself.

He might not have been immortal (indeed still might not), but I doubt he needs to hog them for the sake of his own immortality. Evidently, he only needs to eat one himself. I imagine the purpose of keeping the ToL fruit away from the humans after they become elohim-like is to keep them from challenging the elohim.

chigau (無):

November 20th, 2012 at 10:22 am

Gosh.
The written history of the Nanking Massacre is rather murky.
Whoda thunk?

strange gods before me ॐ:

November 20th, 2012 at 11:54 am

I should probably shut up after 478 but:

So I’m guessing we can’t agree on this.

To not join, I must not indicate what I would say if I were to join.

Examples? The very same comment part of which you quoted

I don’t see.

and then again here

In this case there is little enough that I can guess you are not referring to this:

Note: Lazy, stupid, and evil are your words not mine. If you think that you are these things, I’m sorry, but I certainly don’t think you are.

That leaves this:

Surely it will be a healthy diet if I just boil 2 kg of Spinach which will then have about 700 calories for dinner. Virtually no preparation. Same as potatoes: I really don’t have to peel and cook them, that takes absolutely no time!

If you think that that’s all that constitutes vegn food, and additionally think that there are no vegn quick or convenience foods, maybe you do need to learn a bit about cooking.

The “just boil 2 kg of Spinach” bit was summary. Not a fair summary, so there’s no easy way to respond to it. But it’s strange too. Taken seriously, it did seem to be indicating a notion of what constitutes vegetarian food. That would be exasperating to try to respond to, but if those words should instead not be taken seriously, then it’s not obvious what else should be inferred.

But, before you get to brainstorming about what you would have said instead, remember that you’ve just been told “thank you for making my point by exactly sprouting that fucking stupid shit I just mentioned”, “fucking stupid bullshit”, and “yeah, you’ve just been arrogantly bullshitting”.

I don’t know if words usually called condescending ought to be considered such in response, but whatever.

Don’t you think it’s odd that people who aren’t trying to get it made illegal for you to eat animals are getting allowed fewer faux pas than others, and such quick fuckthoury?

Why not an “alright Captain Obvious” if that’s supposed to be the problem.

chigau (無):

November 20th, 2012 at 12:13 pm

Couldn’t you have just left this discussion over there?

strange gods before me ॐ:

November 20th, 2012 at 12:48 pm

I had a reason not to. I don’t know if it was a good one.

theophontes (坏蛋):

November 20th, 2012 at 1:02 pm

@ SGBM

how does Snake know that the ToKoGaE fruit will not kill the humans

We must not forget that Snake goes much further back than Genesis. Snakes are prescient. It is not just in knowledge that they excel, but also in knowledge of the future. This is the kind of thing they would just know.

“How?”, you ask. Well, here we get back to skyhooks I am afraid. (I have my pet theory, but it is not as given in the Genesis narrative. It need not be “magic”.)

Yahweh punishes Snake out of the blue, without warning.

If true, this would clearly falsify my theory. (Again, within the Genesis fairytale, but not necessarily generally. Snake features in many tales.)

Evidently, he only needs to eat one himself.

I clicked the linky, expecting a perfect godlike website, moderated by the great sages of our age, dedicated to upholding this theory. But it just linked to upthread. I can point you to the FACT that Real Gods ™ do in fact eat Godly Foods ™ (ambrosia, washed down with golden cups of nectar) on a continuous and ongoing basis.

@ chigau

murky

murky ?

chigau (無):

November 20th, 2012 at 1:03 pm

I’m just whinging.
The conversation is hard enough to follow without having it on two threads.

chigau (無):

November 20th, 2012 at 1:12 pm

theophontes
re: Nanking
Mostly the body-counts.
They seem to range from negative numbers to over 400,000.
I agree that the Japanese government needs to make the next move.

Mr. Fire:

November 20th, 2012 at 2:22 pm

YHWH could have been playing with (“punishing”) His Snake for ages before getting frustrated.

So apparently Yaweh’s not just a shit, but impotent too.

And the chaser:

Surely this should have come up earlier?

Perhaps that’s what people really mean when they say God is actually Neo:

“Why oh why didn’t I take the (little) blue pill?”

Beatrice:

November 20th, 2012 at 2:58 pm

strange gods,

sigh
I was attempting to somewhat clarify why Giliell got upset and how some of Nepenthe’s comments seemed a bit unfair to me. Since one of my points was that Giliell’s attempts to explain (which at some point became exaggerated) how taking care of her family’s meals, combined with her other responsibilities, was making it difficult for her to change her diet were being dismissed too carelessly, I tried to see what your position on that was. You obviously didn’t read the same thing I did from Nepenthe’s comments.

If you are only discussing the discussion, without actually wanting to give an opinion on the topic, I really don’t know what we’re supposed to discuss any more. Nepenthe clarified that what Giliell and I (and some others -Holms?) read as condescension was written in honest belief that an average omnivore can’t easily think of a meatless meal. To me personally that’s unbelievable, so I’ll just assign it to cultural differences, I guess.

I do feel bad about some of the things I wrote, like that mini rant directed at Winterwind.

—-
When you relocate a discussion to Thunderdome, could you please give a link on the original thread? I don’t know about others, but I don’t check Thunderdome regularly.

Rutee Katreya:

November 20th, 2012 at 3:34 pm

I’m slightly worried that very little of the Liberal Agenda as presented in Liberal Crime Squad is too far for me. Only their version of Free Speech (Which seems to be the ZOMG EVERYTHING IS FINE PERIOD version) and animal rights (Which is that animals are legally people) seems too far to me.

strange gods before me ॐ:

November 20th, 2012 at 8:51 pm

Beatrice,

Definitely there are cultural differences. People, like, all the time, it’s one of the most common things I hear about it, ask “what do you eat?”

Well, you know how people would react or not react if someone said “you shouldn’t buy these brands of clothing because they have awful working conditions. Some would ignore the information, some roll their eyes. But it’s unlikely that there’s going to be a confrontation simply because someone says “it’s hard” and someone else responds here’s how to do it. Even if people think they are being gauche.

Especially in a related thread. We would not expect “don’t you dare tell me which brands are less bad.” Certainly not on a non-sport blog.

The degree of disparity in reaction is not reasonable. Side-effect of absorbing the hippie-punching ethos, maybe, but lots of people go cruel quite readily on this topic.

strange gods before me ॐ:

November 20th, 2012 at 9:10 pm

theophontes,

We must not forget that Snake goes much further back than Genesis. Snakes are prescient.

Gonna need Canaanite or similar sources to allow this into evidence.

I have my pet theory

On with it! It had better be thicker in the middle.

ambrosia, washed down with golden cups of nectar

Lack of mention would suggest he’s not a big fan. (Different pantheons’ gods have different needs. Yahweh does burnt offerings though.)

chigau (無):

November 20th, 2012 at 11:48 pm

ॐ

On with it! It had better be thicker in the middle.

Like this?
google image search

Owlmirror:

November 20th, 2012 at 11:59 pm

Huh.

503 Server Error

Guru meditation [BIGNUM]

Varnish cache server.

theophontes (坏蛋):

November 21st, 2012 at 12:16 am

@ SGBM

Gonna need Canaanite or similar sources to allow this into evidence.

Ooooh, Canaanite now?

{theophontes puts up “dukes”}

Are you, oh Double-pape ™ going to deny that the Mediteranean, in terms of swapping out religious ideas, was anything but one great big clusterfuck? Or that Zeus was not Norse? But OK. I’ll play along with your little game…

On with it! It had better be thicker in the middle.

cough
My theory:
cough
… by theophontes.

{cue sound of a bridge}

That is “theophontes” not “theopontes”!

Since forever, people have noticed that animals behave in perculiar ways prior to major natural events. These can be prior to spectacular events like the earthquake that clobbered Helice, in Greece in 373 BC (linky). Or the deadly tsunami of more recent times. (linky)

In the short term you might observe the flight of the swallows, catching insects before an impending storm. But more interestingly Snake heading for the high ground to avoid rainstorms – when there is not a cloud in the sky. For priests of the sky-gods, this is a good trick to keep up one’s sleeve.

But why Snake and not, for example, mice? Well, there were many mouse observing priests too. Think Apollo Smintheus. Or consider also Thales of Miletus, who observing the behaviour of mice, deduced that there would be a bumper harvest ahead. He bought up every option on every wine-press he could lay his hands on and became very rich very quickly. There are contenders, but in each case above, who has been out there leading the pack? Snake of course!

chigau (無):

November 21st, 2012 at 12:17 am

Owlmirror #395
yeah.
but it recovered.

theophontes (坏蛋):

November 21st, 2012 at 12:43 am

Curses! I cannot see my cursor in the comment window.

…

Lack of mention would suggest he’s not a big fan.

If YHWH was into apple pie and perry, it does not detract from the idea that gods enjoy their nosh as much as the rest of us. Perhaps YHWH is just a greedy little kid who doesn’t want to share. (Even your heretical “nephelim” theory would back this up. Only that it is power, not peaches that drives his greed.)

Yahweh does burnt offerings though.

There is nothing particular in this. But I would point out that the Gods of Olympus and our very own Boltzmann Brontasaurus consume entire hecatombs at a time. YHWH must be a very small god to eat a mere heffer per burnt offering.

@ chigau

Like this?

Like this.

Owlmirror:

November 21st, 2012 at 1:03 am

I recently watched a show on animal intelligence (Nova ScienceNow) which stated that the Earth is constantly generating infrasound from the mass of the ocean hitting the crust, and that different locales have a different infrasound background signature (and that pigeons use the infrasound signature to find home).

Thoughts: What does an earthquake do to the infrasound background, and when (that is, in relation to the more obvious major waves) does it do it?

Are all animals that panic before earthquakes sensitive to infrasound? Elephants are known to be, and I think snakes are as well.

Are great apes in general sensitive to infrasound, and if so, why did humans lose it?

theophontes (坏蛋):

November 21st, 2012 at 2:12 am

@ Owlmirror

I can’t respond to the infrasound questions (do we have a resident seismologist lurking?). Obviously the earths crust is in a constant process of upheaval and this must be accompanied with vast releases of energy, which may transmit as sound waves as you describe.

What is interesting is that the Chinese were quite confident they could predict earthquakes by the early 70′s. They used a combination of geophysical instrumentation as well as observations of animal behaviour. This all went swimmingly until 1976, when the Tangshan earthquake struck causing huge loss of life (and changing the course of political history too. It showed up Mao for what he really was – a lousy leader when it came to real problems).

The instruments failed to predict due to their readings being disparate. On the other hand the animals of Tangshan were bang on target and put up a real show. But went unheaded. Interestingly, there were all manner of signs in the wells and in the skies. Bubbling gas and fireballs (Tangshan is a major coal mining area), rumbling sounds and strange atmospheric effects.

Surely an old-school oracle would have saved the day.

theophontes (坏蛋):

November 21st, 2012 at 2:50 am

Stop Press: The Use Of Animals In Earthquake Prediction

[Snake]

The Chinese began to study systematically the unusual animal behavior, and the Haicheng earthquake of February 1975 was predicted successfully as early as in mid-December of 1974. The most unusual circumstance of animal behavior was that of snakes that came out of hibernation and froze on the surface of the earth.

[pigeons]

The principal focus of research work in China has been on the behavior of pigeons. Biological studies on pigeons determined that a hundred tiny units exist between the tibia and fibula on a pigeon’s leg. These nerve units are connected to the nerve center, and are very sensitive to vibrations. Scientists determined that prior to an earthquake of magnitude 4.0, which occurred in the area of the study, fifty pigeons that had severed connections between the tibia, fibula, and the nerve centers, remained calm before the earthquake, while those with normal connections became startled and flew away.

Beatrice:

November 21st, 2012 at 2:52 am

strange gods,

I don’t know if you expected me to deny it, but yeah, all you wrote is true.

There were overreactions in the thread. I decided to stick with explaining Giliell’s because I felt I understood why she was getting upset.

Conversations about veganism/vegetarianism do get people more riled up than, as for your example, talk of sweatshops. But I believe that both sides go into that kind of conversation differently. I wouldn’t find it unreasonable if a poor person got upset into incoherence after being asked to justify themselves for not buying from brands that don’t exploit workers. But they usually don’t get asked that, do they? Expectations about food choices are higher.

Unless one has a hired cook, there is also a shitton of everyday worries about cooking, depending on individual situations. People get more upset about food, than about other things, but then again, it’s also something pretty important to most of us. Whether you have to worry about eating noodles seven days in a row, feeding your family noodles seven days in a row or taking into consideration different kinds of health problems of your family members when you buy food/cook, there’s some thought and effort you have to put into this every single day. For some people, this requires quite a lot thought and effort. Again, it depends on individual situations, but putting more on top of maybe many things someone has to consider every day, it can get one’s hackles up.

I’m not denying that things can get very unreasonable, very fast, in these discussions, but I think some reasons behind it are valid.

theophontes (坏蛋):

November 21st, 2012 at 5:05 am

At atheist conferences we have special guest speakers, perhaps Richard Dawkins or Professor Poopiehead makes an appearance. A comedian or singer might take to the stage to liven things up.

The goddists in Pakistan have gone one further. They issue special fatwas to get the crowds thronging: Shariah4Pakistan Conference

I shall attempt to translate the program:

Teh Pogram:

1. The problem with the fucking kaffirs.
2. Declaration of fatwa against the child victim of a shooting. (There will be a intermission of 10 minutes to allow attendees to compulsively masturbate.)
3. Vindictive character assassination of the founder of our nation.
4. Two Minutes Hate ™
5. How to shit on your own carpet: 101.

chigau (無):

November 21st, 2012 at 9:56 am

Why is the poster in English?

strange gods before me ॐ:

November 21st, 2012 at 10:07 am

I don’t know if you expected me to deny it

I didn’t have any particular expectation.

There were overreactions in the thread. I decided to stick with explaining Giliell’s because I felt I understood why she was getting upset.

Okay. It wasn’t clear earlier that you considered it to be an overreaction.

Initially I was responding to you in part because that wasn’t clear, and because it felt unfair to me that you were telling just one person that they were being shitty and condescending after they’d been targeted with “thank you for making my point by exactly sprouting that fucking stupid shit I just mentioned”, “fucking stupid bullshit”, “yeah, you’ve just been arrogantly bullshitting”, the false claims that they were “be[ing] an asshole to everybody” and “thinking you could just tell us we’re lazy and stupid” then “fuck you for being a privileged arrogant asshole on this” — and then you joined in the distortions, suggesting that anyone had called you evil, like these uncharitable distortions are totally just a game to play at others’ expense — then more falsehoods, “Right, I put words to the things you expressed otherwise”, “You’re either really stupid or just dishonest”, “you’Re constantly using comparisons and then get all upset when people object to being compared to the KKK”, “My problem are assholes like you who think they know more about me and my life than I do”, and so on.

I wouldn’t find it unreasonable if a poor person got upset into incoherence after being asked to justify themselves for not buying from brands that don’t exploit workers. But they usually don’t get asked that, do they?

I would ask you to try to find the comment in that thread where someone is asked to justify themselves. In case you don’t want to, I’ll get to my point right now: it’s very late in the thread and cannot account for the first 80% of comments.

What usually happens — and what happened in this case — is that some meat eaters treat the very presence of vegetarians who are talking about why it’s wrong to eat meat as synonymous with those vegetarians asking meat eaters to justify themselves. So all talk about ethics is falsely construed as an interpersonal demand, often with an explicit assertion that “you think you’re better than me” or “you think I’m evil”, and then the vegetarians are attacked viciously for making a demand that they didn’t make.

But those are non sequiturs. If someone says “you should’t buy Nikes”, then that’s what they’re saying: you shouldn’t buy Nikes. This is not synonymous with saying “justify to me your purchase of Nikes”. The difference is important. If some activist wants you to know that you shouldn’t buy Nikes and why not, then they are trying to convey information to you. And if they’re doing so with a public audience besides the two of you, then they are almost certainly trying to convey information to the others as well. There has to be room allowed for this. It is not reasonable to demand that everyone stop saying “X is bad, we should not do X”. Yet, falsely equating “you’re saying X is bad” to “you’re demanding that I justify X” is used as a means of demanding that people stop saying “X is bad”.

(It actually is okay to ask people to justify their actions which affect others’ interests. But that’s a tangent; my point here is that many, evidently most, pro-veg speakers are not trying to have that sort of discussion. This can and should be recognized by everyone: whatever your opinion about whether other people are allowed to ask you to justify your actions, people who are not doing that should not be responded to as if they are. It’s simply not accurate, and thus it isn’t fair.)

Also the equation of “X is bad” to “people who do X are evil” should stop. You know that when you’re telling someone “you shouldn’t do that”, like, for instance, “that’s condescending so you shouldn’t say that”, you’re not saying “you’re evil” nor do you believe they’re evil. And if someone says “you should’t buy Nikes” you don’t assume that they believe and are really trying to express the absurd conclusion that “people who buy Nikes are evil”. This same basic charity should apply to discussions about animals’ lives. We can treat people with the minimal decency of expecting that they mean what they actually say, and that they aren’t secretly jumping to absurdly unjustifiable conclusions.

If we treat every ethical critique as if it really means “you are a fundamentally evil person” then we can’t ever discuss ethics.

Again, it depends on individual situations, but putting more on top of maybe many things someone has to consider every day, it can get one’s hackles up.

Instead of assuming that someone was actually “putting more on top of maybe many things someone has to consider every day”, again I would ask you to try to find a comment in that thread where anyone did this.

What in fact happened was people offered their own reasoning up in a public discussion. Some people are going to discuss some of that reasoning, including critiquing it. This is to be expected. Nobody was being imposed upon. Everyone who participated in that discussion sought it out. They chose to read the OP, they chose to read the comments, they chose to add their own. Heck, if someone wants to add their dubious arguments to a thread and then not experience any critique, there’s even a way to do exactly that: it’s called a driveby comment.

There has to be room for people to say things like “X is bad” and “Y is better”. If someone else can’t deal with that right now, okay, but that doesn’t justify insisting that the other people should stop talking about it — certainly not when there’s also the easy option of really just not dealing with it, i.e. ignoring those people instead of voluntarily joining the discussion.

theophontes (坏蛋):

November 21st, 2012 at 10:18 am

@ SGBM

Wabbing, I see.

(Your arguments have been utterly destroyed. Mwahahaha…)

theophontes (坏蛋):

November 21st, 2012 at 10:24 am

@ chigau

Pakistan was a British colony? It acts as lingua franca, in a country with hundreds of dialects? One of the main speakers is from the UK? It is a show, put on for the media to puff out their inflated egos to a wider audience?

I find it beyond fucking disgusting that they want to put a fatwa on Malala as a publicity fucking stunt. What is wrong with these people?

strange gods before me ॐ:

November 21st, 2012 at 10:42 am

theophontes,

You want more?

Are you, oh Double-pape going to deny that the Mediteranean, in terms of swapping out religious ideas, was anything but one great big clusterfuck?

Yes. It must be something other than a simple undifferentiated clusterfuck if I can say “Canaanite or similar sources please” and you understand why I’m asking for these specifically.

If you want to introduce other Snake stories into consideration for understanding Genesis, then I want to see persuasive reasoning for doing so. (And I’m indicating ahead of time that the relevance of Canaanite sources is already persuasively reasoned for, and thus others might be argued for by demonstrating a relation to Canaan.)

I could declare, by papal bull, that Snake might have weather and natural disaster prediction abilities. It would have no implication for Snake’s knowledge of the effects of ToKoGaE fruit. (And if Snake is generally prescient, why doesn’t he do something to avoid being cursed by Yahweh?)

If YHWH was into apple pie and perry, it does not detract from the idea that gods enjoy their nosh as much as the rest of us. Perhaps YHWH is just a greedy little kid who doesn’t want to share.

Perhaps a lot of things, but such reasoning proceeds by ignoring what the text indicates is important to the story — in this case Yahweh Elohim’s specific preventive measures against, and lament about, the humans becoming “elohim-like”.

Even your heretical “nephelim” theory

See: Rutee and Owlmirror. I haven’t said anything about nephilim.

theophontes (坏蛋):

November 21st, 2012 at 10:46 am

Tom Gilson, who is a liar for jeebus and has run into our Ebil Oberlawd on more than one occasion, has joined the recent asshattery of the American far-right: Preparing for Persecution

What is interesting about this person is that he endevours to bring a “scientific/rational” slant to his pressupositions. He spews the same lies as others in his creepy death-cult, but then qualifies them with riders. Peruse the comments on the graph that was sucked out of someone’s thumb.

(If you are thinking of leaving a comment, bear in mind that Tom Gilson is a hypocritical fuck and will only entertain ideas that are congruent with his own crackpot religious views.)

chigau (無):

November 21st, 2012 at 10:47 am

Did the snake have feet before being cursed?
If you are already ‘crawling on your belly’ being cursed to ‘crawl on your belly’ is not much of a curse.

strange gods before me ॐ:

November 21st, 2012 at 10:52 am

Well, it’s implied to be a change. Anyway there are two more components to the curse: Snake will eat dust, and be despised and attacked by humans.

Beatrice:

November 21st, 2012 at 11:06 am

strange gods,

It’s not fair, really. You can’t just go and write a completely reasonable comment that I can’t really disagree with.

Ok, I can disagree a bit. Or rather, repeat my attempt at an explanation.

Instead of assuming that someone was actually “putting more on top of maybe many things someone has to consider every day”, again I would ask you to try to find a comment in that thread where anyone did this.

I already mentioned how I thought Nepenthe was being condescending. That wasn’t her intention, but that’s how both Giliell and I read it. It sort of went downhill from there (if we ignore parts with mouse at the beginning and some short skirmishes).

In the comment before this one, I tried to explain why* some omnivores may have reacted as they have. Condescension or making someone feel like they should justify themselves may not have been anyone’s intent (until SC’s comment), but again, I tried to explain why people may be more inclined to read innocent comments that way in this context, while behaving more reasonably in any other.

I’m aware that I also went overboard at some points. It’s pretty ironic given that I started off with a “we should all try to get along” comment.

Nepenthe apparently didn’t believe either Giliell or me when we said that we know how to cook cook things apart from meat, so assumptions all around

theophontes (坏蛋):

November 21st, 2012 at 11:28 am

@ SGMB

I want to see persuasive reasoning for doing so

I have indicated that there is a very Real Life ™ reason why any society can develop a profound understanding of snakes as being prescient. (examples have been provided from divergent times and cultures around the world, these can be multiplied many times over). This abrogates the need for making a specifically Canaanite link. They could generate this understanding ex nihil* in little time. Being taken for granted by everyone that works the land (both in terms of practical usefulness and intrusion into general folk-superstitions) this is not reflected in the bible, simply because it was taken as commonplace fact at that time.

In terms of the “religious clusterfuck” idea: This does have its detractors (for the example of Heracles and the Snake/s) in the case of the Greeks. We know that they travelled extensively to the Levant (which contains Canaan) and that there would be a real measure of interchange of ideas. In fact this is brought up clearly by Robin Lane Fox (Travelling Heroes: Greeks and their myths in the epic age of Homer): The Greeks travelled widely for a time and came into contact with the Levant. They went through a long period of stagnation and then later went back to discover the incredible correlations there with their own myths. They took this in some measure as a vindication of their religious ideas, but in essence they had only rediscovered what they had set in motion in an earlier age (either/both as teachers and/or learners… this last is not completely clear)

It would have no implication for Snake’s knowledge of the effects of ToKoGaE fruit. (And if Snake is generally prescient, why doesn’t he do something to avoid being cursed by Yahweh?)

I can see that this would be a problem if Snake was required to be ALL knowing instead of merely knowledgeable. There could be gaps (as there literally are in RL) as to what Snake is capable of being aware of. Also notice that Snake is a master of hiding out. Snake might very well have perused YHWH guzzling fruit and put two and two together. If such details were explicitly covered in Genesis, it would be the size of the babble itself.

I haven’t said anything about nephilim.

{thinks: “rats, curses … and other expressions of extreme frustration, why oh why did I have to fluff that one up”}

Elohimish not Nephalimish…

{tries to hide blushing, slinks off}

theophontes (坏蛋):

November 21st, 2012 at 11:44 am

This is the view from my window. It is dark. It is late. Time to Zzzzzz…

ChasCPeterson:

November 21st, 2012 at 12:11 pm

Snake was already legless, but previously crawled on its back. This helped keep its mouth out of the dust.

strange gods before me ॐ:

November 21st, 2012 at 1:27 pm

I imagine we’re agreed that to explain is not to excuse.

If a pro-veg person is approached by someone inviting affirmation for meat eating, they can ignore, disagree with parts, and/or say it’ll get easier in the future. Sometimes the safest thing is to ignore, but even that may be considered rude since they’ve been approached.

Can we agree it’s not very sensible to approach a pro-veg person who did not approach [generic you], and ask them to say something approving about eating meat? (Can moreover be perturbing?)

Beatrice:

November 21st, 2012 at 1:54 pm

strange gods,

Aren’t you simplifying this a bit? There were a couple of parallel discussions going on, with people discussing pro-vegan points and others the opposite. You can’t turn that into “an omnivore asked a pro-vegan person to say something approving about former’s meat eating” as if it came out of the blue, completely out of context.

Beatrice:

November 21st, 2012 at 2:08 pm

I’m not going to analyze every comment on that thread, so I will only repeat that I have overreacted.

But don’t you exaggerate the “abused vegans” part either.

Beatrice:

November 21st, 2012 at 2:25 pm

“abused vegans pro-vegans”

jonmilne:

November 21st, 2012 at 3:03 pm

There’s a very insightful chat between Ricky Gervais and Richard Dawkins that appears on YouTube. Parts of this debate got used in a recent documentary Dawkins has filmed, but this is the full interview. If you have 15 odd minutes to spare, by all means check it out :) :

strange gods before me ॐ:

November 21st, 2012 at 7:06 pm

But don’t you exaggerate the “abused vegans” part either.

That’s profoundly unhelpful. Please, either substantiate your claim that I’m exaggerating something — quotes would be nice — or don’t make empty assertions like that.

I’ll be specific. I’m not calling anything “abuse” here, so I’d appreciate if you don’t put that word in my mouth. And my #416 says nothing about any overreaction anyway; it’s about whether it’s “sensible to approach a pro-veg person who did not approach [generic you], and ask them to say something approving about eating meat”. That’s what it’s about: what’s sensible to expect of another person; not even what’s fair, not anybody’s overreaction, and certainly nothing about “abuse.”

But, regarding the degree of unfair behavior, since you are suddenly (weirdly) suggesting I’m exaggerating something, let’s be perfectly clear.

All this: one person being «targeted with “thank you for making my point by exactly sprouting that fucking stupid shit I just mentioned”, “fucking stupid bullshit”, “yeah, you’ve just been arrogantly bullshitting”, the false claims that they were “be[ing] an asshole to everybody” and “thinking you could just tell us we’re lazy and stupid” then “fuck you for being a privileged arrogant asshole on this” — and then you joined in the distortions, suggesting that anyone had called you evil, like these uncharitable distortions are totally just a game to play at others’ expense — then more falsehoods, “Right, I put words to the things you expressed otherwise”, “You’re either really stupid or just dishonest”, “you’Re constantly using comparisons and then get all upset when people object to being compared to the KKK”, “My problem are assholes like you who think they know more about me and my life than I do”, and so on.»

That was unreasonable, inaccurate, and unfair — and those are actual quotes; I can’t exaggerate them — and there was no equivalent from the other side. There’s my case, succinctly. If you want to try to make the case that someone on the other side was treated as unfairly, you are welcome to show some evidence.

cm's changeable moniker:

November 21st, 2012 at 7:20 pm

theophontes: “This is the view from my window. It is dark.”

No, it’s not. That’s what’s keeping you awake. ;-)

cm's changeable moniker:

November 21st, 2012 at 7:35 pm

Oh, and somewhat related, I recently had an email correspondence with someone from Hangzhou. To my discredit, I didn’t even know Hangzhou was a place, let alone a place with a UNESCO heritage site.

Globalisation is confusing. I need an atlas. And a drink.

SC (Salty Current), OM:

November 21st, 2012 at 8:17 pm

I’m probably not helping, but…

Both Giliell and hotshoe said in that thread that they disagree with [whatever the hell they in their ignorance understand to be] the arguments for veganism. So they have no desire to become vegans, and the practical question of becoming vegan is pretty much irrelevant.

Now, I’ll argue with people who put forth arguments against the ethical case for veganism. But what is the point of arguing with someone who fundamentally disagrees with [their understanding of] that case but wants to dwell on alleged practical difficulties? Especially when they can keep noting (or inventing) conditions at will, and no one can make the contrary case for their specific situation?

In what world is that valid? Should I spend my time arguing about the difficulties of finding designated drivers and drinking in locations without adequate public transportation with people who don’t agree with arguments against driving drunk, with the principle that we collectively should avoid it and find solutions that collectively avoid it? Or should I address the people who share my values but are looking for practical solutions? I think the latter.

theophontes (坏蛋):

November 21st, 2012 at 10:10 pm

@ cm’s

That is a veritable blackout by Shenzhen standards.

Hangzhou

{with mock disdain}That little hick town. (Don’t worry, most people likely don’t know Shenzhen exists.)

@ Chas

Oops, I forgot to mention that turtles and totoises are prescient also.

chigau (無):

November 21st, 2012 at 10:55 pm

totoises
Are we in Kansas?

strange gods before me ॐ:

November 21st, 2012 at 11:00 pm

Rereading 421 “it looks like fighting” but I don’t want that. Meh. I said I should shut up.

theophontes (坏蛋):

November 22nd, 2012 at 12:44 am

@ chigau

{theophontes, in tone of great munificence}
Here, have an “r”. Oh to hell with it, let’s go large: Have an “R“!

(I am sure that toRtoises in Kansas are also “prescient”.)

John Morales:

November 22nd, 2012 at 12:49 am

theophontes, they ain’t prescient; they are reactive.

Owlmirror:

November 22nd, 2012 at 1:33 am

So, I hit Google Scholar for [snake cult Levant], and trudged through the hits.

Alas, it looks like many of the refs are simply not online.

Still:

To be sure, snake figurines and other items with snake motifs have been found at Tel Kinrot (Faßbeck et al. 2003, 50- 51 with Abb. 83a-b), Hazor (Yadin 1960, pls CCCIX, 8 and CCLXXVIII, 20; cf. the bowl onto the body of which a clay-sculptured snake was applied; see Yadin et al. 1961, pl. CXCVI, 13 and Yadin et al. 1989, 223; Keel 1992, 234, Abb. 186), and many other sites (see the inventory of the Syro-Palestinian snake iconography in Keel 1992, 195-266; see also Buchholz 2008), demonstrating that the snake was a prominent religious symbol even in the Early Iron Age in the Southern Levant as in the Near East in general [24].
_______________________________________________
24 The evidence is compiled by Koh 1994; according to his inventory, the number of sites with snake objects decreases dramatically from the Late Bronze Age to the Iron Age. Generally on the topic, cf. Buchholz 2000. For a more distant Iron Age example from the Gulf area (ancient Oman), see Benoist 2007.

Refs :

Buchholz, H.-G. 2000. Furcht vor Schlangen und Umgang mit Schlangen in Altsyrien, Altkypros und dem Umfeld. Ugarit-Forschungen 32, 39-169

Buchholz, H.-G. 2008. Bemerkungen zur ostmediterran-vorderasiatischen Schlangen-Ikonographie. In S. Bar (ed.), In the Hill-Country, and in the Shephelah, and in the Arabah (Joshua 12,8): Studies and Researches presented to Adam Zertal in the Thirtieth Anniversary of the Manasseh Hill-Country Survey, 56-69. Jerusalem:

Faßbeck, G., Münger, S. and Röhl, S. 2002. Gotteshaus und Hausgott – Ausgewählte Hinweise auf möglichen Hauskult im antiken Kinneret. In G. Faßbeck, S. Fortner, A. Rottlof and J. Zangenberg (eds), Leben am See Gennesaret. Kulturgeschichtliche Entdeckungen in einer biblischen Region, 47-51, 207. Mainz: Philipp von Zabern Verlag

Keel, O. 1992. Das Recht der Bilder, gesehen zu werden. Drei Fallstudien zur Methode der Interpretation altorientalischer Bilder. Orbis biblicus et orientalis 122. Fribourg and Göttingen: Universitätsverlag Fribourg and Vandenhoeck & Ruprecht

Koh, S. 1994. An Archaeological Investigation of the Snake Cult in the Southern Levant: From the Chalcolitic Period through the Iron Age. Unpublished PhD thesis submitted to the University of Chicago

Yadin, Y. 1975. Hazor. The Rediscovery of the Great Citadel of the Bible. London: Weidenfeld and Nicholson

Yadin, Y., Aharoni, Y., Amiran, R., Dothan, T., Dunayevsky, I. and Perrot, J. 1960. Hazor II. An Account of the Second Season of Excavations, 1956. Jerusalem: Israel Exploration Society

Yadin, Y., Aharoni, Y., Amiran, R., Dothan, T., Dothan, M., Dunayevsky, I. and Perrot, J. 1961. Hazor III–IV. An Account of the Third and Fourth Seasons of Excavations, 1957-1958. Plates. Jerusalem: Israel Exploration Society

Yadin, Y., Amiran, R., Ben-Tor, A., Dothan, M., Dothan, T., Dunayevsky, I., Geva, S. and Stern, E. 1989. Hazor III–IV. An Account of the Third and Fourth Seasons of Excavations, 1957–1958. Text. Jerusalem: Israel Exploration Society

Link for above:
http://www.kinneret-excavations.org/download_files/nissinen_muenger_fs_van_der_kooij_2009.pdf

Some of the hits had some amusing speculation, like seeking to identify Dionysus with Yahweh, at least partly through shared snake-imagery.

b. Common Symbols
Snakes. Dionysus is surrounded by snakes: the god is born in a nest of serpents. As a boy, he is generally shown holding serpents, and later, he is symbolized as a mythical snake.18 The cult of Dionysus also involved the handling of snakes by Maenads, confirming his intimate association with this animal.19 Sabazius, the Thracian homolog of Dionysus, was also symbolized as a snake and this reptile played a central role in his cult.20 Yahweh is also described as surrounded by burning snakes (seraphim) by Isaiah (6.1-3), and flying snakes are sent by Yahweh against the enemies of Israel (Isa. 14.29). Here again, this association is devoid of any specific significance in a monotheistic context, where Yahweh reigns over the whole Universe. Nevertheless, the fact that the transformation of a staff into a snake (Exod. 4.1-5) is considered as the specific sign ensuring that Moses speaks in the name of Yahweh suggests that Yahweh is ore closely related to snakes than assumed by the monotheistic exegesis. This point is corroborated by the worship of Yahweh as a bronze snake (nehushtan) in Jerusalem, until the religious reform of Hezekiah.21

hmph.

dysomniak, darwinian socialist:

November 22nd, 2012 at 1:46 am

Alan Moore has some interesting opinions on snakes: http://youtu.be/Cam2kK7J_8k

theophontes (坏蛋):

November 22nd, 2012 at 1:57 am

Therefore the “” in the above. (In principle I agree with you though.)

I use the word in the sense of how they may be perceived by an earlier age. The animals appear, as if by magic to know what is coming, be it storm or earthquake. It would appear to an ignorant (by our lights) observer that they are indeed prescient. In terms of our discussion of Snake, we complicate the argument for this perceived prescience by imposing from the outside, as it were, knowledge that humanity has gained only very recently (and only in part).

The whole Snake story is complicated by being in onion-like layers:

1. The story of Genesis (which in itself can be read on different levels).
2. The local historical context in Canaan.
3. The impact of cultures and circumstances outside of the area in question.
4. The global realities, impinging on all of the above, that we now know.
5. … and (obviously we are learning more all the time, also we should add a “0.” above. Genesis likely grew out of much earlier oral traditions.)

Consider Snake’s “prescience” in each level in turn:

0. Prescient.
1. Prescient.
2. Prescient.
3. Prescient.
4. Reactive.
5. Reactive (I shall stick my neck out here.)

We now know the situation is like the brontosaurus. Whereas snake was aware of the whole brontosaurus, mere humans were only aware of the fat middle bit. They simply could not perceive the thin bits at either end, so that their awareness only began when matters were upon them. With science we can now get to the neck. In future we shall feel the breath on its nostrils and breathe a sigh of relief.

theophontes (坏蛋):

November 22nd, 2012 at 2:31 am

@ Owlmirror

Trying to lead the minions astray again, Owlmirror?

(There is also the Dionysus —> Jeebus —> YHWH angle but sadly, AFAIK, without Snake.)

@ dysomniak, darwinian socialist

Alan Moore has some interesting opinions on snakes

And here I sit without access to youtube. :’(

@ SGBM

My PC conked out recently so I lost TOR. I could reload the file you sent, but have forgotten the passwords to download it. Do you recall? Some characteristic of tardigrades?

Beatrice:

November 22nd, 2012 at 3:45 am

If a pro-veg person is approached by someone inviting affirmation for meat eating, they can ignore, disagree with parts, and/or say it’ll get easier in the future. Sometimes the safest thing is to ignore, but even that may be considered rude since they’ve been approached.

This can be read as implying some sort of danger of abuse from the person approaching them. You didn’t mean that? Ok then, good.
I’m reading too much between the lines. I sometimes do that.

I already wrote everything I intended to write about this. I don’t know what the hell you want from me. I didn’t write “both sides were equally wrong”.

It’s really great if you can go through 450+ comments thread and discuss it for days afterwards, but I can’t. Well, I probably could, but I really don’t want to.

I’m going to disengage from a conversation I don’t want to be a part of any more, since no one is forcing me to argue.

So, I’m shutting up about this. There will a ven thread again sooner or later and then we’ll see how discussions go.
I’ll try to do better, or ignore the whole thing if I feel shouty.

Owlmirror:

November 22nd, 2012 at 8:37 am

(There is also the Dionysus —> Jeebus —> YHWH* angle but sadly, AFAIK, without Snake.)

Or so one might think. Yet the snake sheds its skin, and is thus a brilliant symbol for a dying and resurrecting god.

I suspect that the snake may have been associated with Asherah rather than with Yahweh, and so perhaps Genesis 3 was part of the campaign by Yahweh monolatrists to divorce Yahweh from Asherah and all of the symbols of Asherah.

Which explains how Snake knows what the fruit of the ToKoGaE will do and not do — he was hanging out with Asherah.

Referencing this:

This point is corroborated by the worship of Yahweh as a bronze snake (nehushtan) in Jerusalem, until the religious reform of Hezekiah.

I read another text in Google Books that describes the Ugaritic pantheon of which Yahweh and Asherah were once part, and explains it as a multilevel hierarchy, with the highest god (or gods) at the top, lower gods (and the “sons of the Gods” of Genesis 6 are suggested as being such lower gods), and messengers/slaves of the Gods at the lowest rank. The text identifies nechushtan as being an example of just such a low-ranking messenger/slave God; not Yahweh himself, but an intermediary assigned to handle snakebite cases on Yahweh’s behalf.

theophontes (坏蛋):

November 22nd, 2012 at 9:15 am

@ Owlmirror

the snake sheds its skin

Further: The snake also hibernates. Ie it goes underground into the realm of the dead and their cthonic rulers for winter and is therefore an ideal symbol for a year-god. (goddists get irate when you remind them jeebus is a year-god)

Asherah

It is easy to forget that there was ever a matriarchy and that the priestess held more power than the king. With the rise of the patriarchy all these godesses and their symbols would have to snuff it too. Snake would inevitably become demonised.

a multilevel hierarchy

A very good point to raise. Religion was much of a multi-nested heirarchy that extended from the heavens all the way into the household. YHWH and his Asherah would be seen in the king and his priestess/queen would be seen in the husband and his wife.

The whole idea of “Lord” also gets found in the king and in the landowners. His (in the patriarchy) word, on any level, would be absolute. Sin would be any challenge to this order and the evil must be rudely beaten out. (Spare the rod and spoil the child. There are no such things as “mistakes” – error is indicative of Teh Ebil ™ and must be physically removed.)

theophontes (坏蛋):

November 22nd, 2012 at 9:54 am

We must not forget that Adam only hit it off with Eve after his torrid affair with Lilith ended. Lilith went on to live in the desert with all her pets, including arrow snakes. Interestingly, KJV and a few other bibles get this all wrong:

There shall the great owle make her nest, and lay and hatch, and gather vnder her shadow: there shall the vultures also be gathered, euery one with her mate. — KJV Isaiah 34:15

(My emphasis, not Isaiah’s)

Nowadays we know he really meant Snake (notice it is Mrs Snake and her kids):

There shall the great owl – (קפוז qı̂pôz). Gesenius supposes that this is the arrow-snake, so called from its darting or springing, in the manner of the rattle-snake – from an obsolete root to draw oneself together, to contract. Bochart (Hieroz. ii. 3. 11. 408-419) has examined the meaning of the word at length, and comes to the conclusion that it means the serpent which the Greeks called acontias, and the Latins, jaculus – the arrow-snake. The serpent is oviparous, and nourishes its young.

Linky.

Under her shadow – This might be done by the serpent that should coil up and cherish her young.

Not only is Snake a beautiful serpent, she is also a loving and caring parent.

dysomniak, darwinian socialist:

November 22nd, 2012 at 10:17 am

theophontes: until you’re out from behind the Great Firewall, perhaps this interview can tide you over.

theophontes (坏蛋):

November 22nd, 2012 at 10:59 am

More about Lilith, and why she was removed (quite late in the day) from the bible. To be replaced by a screech-owl. (Only found in the Americas, incidentally!)

Link: Adam’s First Wife: The Story of Lilith

Owls Owlmirror!

theophontes (坏蛋):

November 22nd, 2012 at 11:04 am

@ dysomniak

Thanks for the link! (Although it is a both a blessing and a curse )

Owlmirror:

November 22nd, 2012 at 11:06 am

Lilith as Adam’s first wife is actually much much later; from Babylonian mythos interwoven with Hebrew midrash .

Don’t confuse midrash with what the original authors and audience had in mind.

Dhorvath, OM:

November 22nd, 2012 at 11:25 am

SG,

What usually happens — and what happened in this case — is that some meat eaters treat the very presence of vegetarians who are talking about why it’s wrong to eat meat as synonymous with those vegetarians asking meat eaters to justify themselves.

This troubles me. I do this, or at least I think I do. When a group or person talks about the problems with something I do, I will join their conversation with some of the reasons that I continue. And in an example of basically the very thing you are saying is unfair, I feel inclined to defend acting that way.

What we do matters to a lot of people. Being exposed to people who think our behaviour should be avoided, not just as a matter of taste, but in an imperative manner, is an injunction regarding our behaviour. It may not be successful, but it is at the least playing some role in our future decisions. Reacting to that is not wrong.

Owlmirror:

November 22nd, 2012 at 11:46 am

Adam’s First Wife: The Story of Lilith

Fiddlesticks.

Midrash is not about finding sekret characters that were removed; it’s about backfilling and making stuff up (or importing from other mythos, sometimes) to explain discrepencies that arise because the bible is not a unified coherent narrative written by one author with a clear narrative vision.

Genesis 1 is a Priestly narrative, describing the actions of a lofty high God, speaking and commanding the earth to obey, which it does.

Genesis 2 is an earlier Yahwehist story, about a more hands-on and human-like god making men from mud and women from a rib.
(which may result from a confused taleswapping from the Sumerian)

Ninhursag: “My brother what hurts thee?”
Enki: “My side hurts me.”
Ninhursag: “To the goddess Dazimua I give birth for thee.”
Ninhursag: “My brother what hurts thee?”
Enki: “My rib hurts me.”
Ninhursag: “To the goddess Ninti I give birth for thee.”
(Kramer, Sumerian Mythology 58)

Each of the eight healing deities has a name that sounds like the name of the body part that needs healing. Kramer finds one of these double names to be significant:

Now the Sumerian word for “rib” is ti (pronounced “tee”). The goddess created for the healing of Enki’s rib, therefore was called in Sumerian Nin-ti, “the lady of the rib.” But the very same Sumerian word ti also means “to make live.” The name Nin-ti may thus mean “the lady who makes live,” as well as “the lady of the rib.” In Sumerian literature, therefore, “the lady of the rib” came to be identified with “the lady who makes live” through what might be termed a play on words. (Kramer, Mythologies 103)

Kramer suggests that the passage in Genesis where Eve, “the mother of all living” is taken from Adam’s rib may be an echo of this Sumerian pun, though he is quick to point out that “the Hebrew word for ‘rib’ and that for ‘who makes live’ have nothing in common” (Mythologies 103). I suppose it is possible that Eve (“life”) was taken from Adam’s rib (and not some other body part) because of some dim recollection of this Sumerian rib / life pun. I should note, however, that in the Bible the two terms are separated: Eve is created from Adam’s rib at Genesis 2:21-24, but she does not receive her “life” name until Genesis 3:20.

theophontes (坏蛋):

November 22nd, 2012 at 11:49 am

@ Owlmirror

Do you mean the replacement of “Lilith” in the bible was in error because it did not mean what the Marians thought it meant? (a bird mistranslated as demon/woman falsified back to a bird)

(I have just finished drinking a bottle of “Hemp Seed Deluxe with Oat Drink”. I trust it is not affecting me.)

….

Interesting Link: The scopes trial set out as part of a law sylabus. To skip to the bit about genesis go here. (I downloaded Inherit The Wind a while back and watched it again recently. I must try and find the link to share.)

theophontes (坏蛋):

November 22nd, 2012 at 11:57 am

@ Owlmirror

The “go here” in my above post relates what you posted wrt two stories of Genesis.

Owlmirror:

November 22nd, 2012 at 11:58 am

Link for text cited @#443 above:

http://faculty.gvsu.edu/websterm/SumerianMyth.htm

======

Also from “Adam’s First Wife: The Story of Lilith”:

a lullaby, or rather a “Lilith, abi”, meaning “Lilith, begone.”

Rage at linguistic bullshit rising… rising…

Aaaaargh!

theophontes (坏蛋):

November 22nd, 2012 at 12:12 pm

@ Owlmirror

I pressume you meant by:

Midrash is not about finding sekret characters that were removed

This:

In developing the Midrash to explain Lilith’s presence in the Bible,

I thought that particular inferrence referred to Isaiah’s (34:15) Lilith, not creating a Lilith from thin air. They are considering her presence in the babble. Why would they need to explain things (sekret characters) that were not there (removed) anyway?

Owlmirror:

November 22nd, 2012 at 12:16 pm

Do you mean the replacement of “Lilith” in the bible was in error because it did not mean what the Marians thought it meant?

No, I meant what I wrote: That Lilith was only thought of as being Adam’s first wife as the result of much later mythological conflation, and cannot really be claimed to be a “discovery” of something that was redacted/omitted.

I was not referring to the translation of Isaiah 34:14, although I will mention, yet again, that Isaiah is a damn weird book with many strange and hard-to-decipher words and phrases.

I mistrust the source you link to, though. I call bullshit not just on his etymology of “lullaby”, but also on his biology. The restriction of “screech owl” to the New World is the result of modern ornithological nomenclature. I insist that there are plenty of owls in the old world that make vocalizations that could be called screeches, and precise organization of those owls into modern phylogenies where their names do not include “screech” is very recent indeed.

theophontes (坏蛋):

November 22nd, 2012 at 12:26 pm

@ Owlmirror

Rage at linguistic bullshit rising… rising…

Aaaaargh!

Aaaaaaaargh!

That post was very much a cut and paste job. Some good, some bad. I recognise where some issues raised are coming from, others are obviously of dubious origin. (I am new to and intrigued by the whole Marian story.)

chigau (無):

November 22nd, 2012 at 12:55 pm

Rage at linguistic bullshit rising… rising…

owlmirror
‘owl’ was originally ‘wol’ onomatopœia from the call of the rare diurnal owl Aegolius bafflegabus.
‘mirror’ was originally a palindrome ‘mirrim’ but a typesetter got drunk.
(This is fun!)

cm's changeable moniker:

November 22nd, 2012 at 6:53 pm

In completely unrelated news, I won on the Euromillions lottery! After subtracting the price of the ticket, I am now £0.60 richer. (Americans, that’s about what you would call “a buck”.)

I’m not sure it was worth the walk to collect it, but damn, it’s something. ;-)

cm's changeable moniker:

November 22nd, 2012 at 7:15 pm

In totally unrelated news, I have had a bit of a lightbulb! moment.

The misbehaving laptop (on which I’m typing) only misbehaves when put into sleep mode by closing the lid. If I shut it down properly (using the wildly unintuitive Start menu), it’s fine. So … I now suspect that the damn thing thinks the lid is closed even when it’s reopened, and the power button (this is me: on! off! on! off!) is being ignored until I leave it for a while and then open it more carefully.

Experimental data will be acquired. If I’m right, it might even get reported.

carlie:

November 22nd, 2012 at 7:40 pm

cm – I’m sure this is what you’re doing, but you could go into the power settings and change it to not go to sleep at all when closed, and see if that resolves the problem.

strange gods before me ॐ:

November 22nd, 2012 at 10:01 pm

Beatrice,

I assume you saw my 427. I don’t want anything from you. I sort of want to answer certain sentences and I sort of want to shut up. Time will tell. If I don’t shut up, it doesn’t mean that I feel like you have to reply to me. I understand not wanting to continue a conversation, and I do it all the time. I don’t think you have my email address: this or this will work.

+++++
Dhorvath,

This troubles me. I do this, or at least I think I do. When a group or person talks about the problems with something I do, I will join their conversation with some of the reasons that I continue. And in an example of basically the very thing you are saying is unfair, I feel inclined to defend acting that way.

Well, I’m not trying to complain about people merely wanting to defend what they do. If people want to do that that’s understandable and arguably rational. What I mean to specify is, in addition, declaring that you have a problem with the way you’re being made to defend yourself, when you aren’t in fact being made to defend yourself. And I’m using that as a segue for a tone argument. I know! But being a hypocrite doesn’t mean I’m wrong about this: haterade based on inaccuracy is to be avoided.

Being exposed to people who think our behaviour should be avoided, not just as a matter of taste, but in an imperative manner, is an injunction regarding our behaviour.

Injunction though? [checks dictionary] I dunno. Do you feel like “boycott Nike” person is giving you an injunction? Whatever you want to call that, people generally react approximately reasonable when told they shouldn’t buy some brand. I am suggesting that type of reaction is also appropriate for people talking about veganism.

+++++
theophontes,

There’s a new version. 32 or 64 bit?

theophontes (坏蛋):

November 22nd, 2012 at 11:55 pm

@ SGBM

Both machines (PC and laptop) are 64 bit. I am running Ubuntu 12.04.

Muchas Gracias!

{pours further libations to Teh Boltzmann Brontosaurus, toasts the health of Mrs Snake and her family.}

I am still on theophontesAThotmail

Dhorvath, OM:

November 23rd, 2012 at 5:41 am

SG,
Thanks for clarifying. It’s the degree of vehemence that is notable, not that there is response.

As for injunction, I can see it’s not the best word to convey the notion. I didn’t want compulsion, it’s too strong for what I meant, but I didn’t want to discount that it is an influence. When people start talking about ethics and morals they are drifting into should and ought territory, not can and might. The dialogue differs, at least for me, and based on my experience for other people as well. So when a person says “Don’t buy Nike”, it’s possible that they had a bad experience with the product, but when they say “Don’t buy Nike, because they rely on the labour of children” there is an ought, or several, tied up in their statement, (that children shouldn’t be employed in making corporations or their elders wealthy for example.) Hearing about things that a company/industry does that I think shouldn’t be done has an impact on my future inclination to support them, injunction seemed to fit, but now I am wishing I had used some other word instead.

rq:

November 23rd, 2012 at 5:58 am

To all of those having the Yahweh-Snake-Genesis-etc. discussion, thank you! It’s quite fascinating. All kinds of things I never knew. (You have secret readers, is what I’m trying to say. ;) )

strange gods before me ॐ:

November 23rd, 2012 at 6:54 am

theophontes,

After I asked, I thought, why don’t I just send both. So I started uploading this last night. Download it if you can, and let me know when you’ve got it saved. If you can’t download it then we’ll try email.

strange gods before me ॐ:

November 23rd, 2012 at 11:39 pm

Our tardigrade has been disappeared? :(

theophontes (坏蛋):

November 24th, 2012 at 12:25 am

@ rq

Yahweh-Snake-Genesis-etc. discussion

I blame Owlmirror, sockpuppet of Rebecca Watson.

@ SGBM

Our tardigrade has been disappeared? :(

No, just been struggling to renew my resident’s visa for China. I had to spend a whole week on the mainland to get it. Obviously they have not put my escapades with Jeebus into my PSB files.

Thanks for the linky, I’ll try fixing that this weekend. I’ll give you a shout if I get stuck.

We have fans of our Snake disputations. Time to step up to the plate again Your Papieness.

theophontes (坏蛋):

November 24th, 2012 at 5:42 am

Hours to stop Uganda’s horrific anti-gay law (Link here)

Sometimes I feel ambarassed to be African. Rather than reminding me that that is silly, please follow above linky and add yourselves to the petition.

(There will be a special tardigrade dance if the petition gets pharyngulated over a million.)

theophontes (坏蛋):

November 24th, 2012 at 5:58 am

@ SGBM

Downloaded the file, but it needs a password.

{looks around}

Hoh hum, … where is the Doublepape?

theophontes (坏蛋):

November 24th, 2012 at 8:15 am

Genesis by Grimes feat. Snake

Owlmirror:

November 24th, 2012 at 9:00 am

HPLovecraft: FAIL

ShadowOver: FAIL

squamous :FAIL

Cthulhu: FAIL

I no can haz sykik powaz!

theophontes (坏蛋):

November 24th, 2012 at 9:23 am

Minitrue Propaganda Video:

Tardigrades: Adorable Extremophiles

With or without psychic powers – how can mere humans compete?

strange gods before me ॐ:

November 24th, 2012 at 10:29 am

theophontes,

Downloaded the file, but it needs a password.

Yes, the “download first, then receive password” protocol is my quick and dirty layer of protection against MITM.

Your password is:

TheTa,rdigr>adeId\entit/y

jonmilne:

November 24th, 2012 at 3:40 pm

Hey guys, another debate I’m having, but this one’s actually against someone relatively big, albeit only big enough to warrant a passing mention on RationalWiki’s entry on Potholer54. Anyhow, a search for Juby on FTB yielded nothing, so I figured Juby was due a bashing.

Anyhow, long story short, Juby’s gotten pissed that I called him out on his crap. Specifically, he believed that evolutionary theory not only had zero impact on medical advancements and science, but also had a detrimental effect that was apparently demonstrable (and he actually cited vestigial organs, junk DNA, and the origin of Planets and the Moon as evidence for his claims… Yeah), and he also tried to use Edwards vs Aguillard as proof that Creationism deserved a place in the classroom, only for me to school him in exactly what the ruling and happenings were in that case, and how it relates to the sealed fate of ID/Creationism in Kitzmiller v Dover, and I gleefully pointed out just how badly ID advocates got completely owned on the stand.

Well surprise surprise, he threw a tantrum, saying that K v D doesn’t prove anything (convenient, that) and he asserted that the Prosecution’s witnesses lied on the stand (with no evidence for this in the way that there’s evidence that Behe and Bonsell definitely lied on the stand).

He also got angry because when he asserted that “religious people who believed in theology helped build the foundations of modern science”, I pointed out that such people existed at a time when a) they would have had to have been religious to even receive any form of education, and b) anyone openly atheist and contrary to the Creation story belief would have been killed on the spot, and c) he’s still ultimately relying on both Biblical Inerrancy and the word of people who were ignorant about what science would be able to discover.

After he finished his tantrum accusing me of dishonesty and willfully peddling false information (I wasn’t) he then linked me to his site which he claimed rebutted my beliefs about evolution, specifically pointing me to Section 5: “More Chimp and Human DNA Stuff” as evidence for his claims. The link is here: http://ianjuby.org/newsletter/?p=489#5 As someone who isn’t entirely the best in terms of “scientific” stuff, I’d appreciate any help here with what he claims in that section.

Much thanks,

Jon

theophontes (坏蛋):

November 24th, 2012 at 11:39 pm

@ SGBM

MITM

Huh?

{tap,tap,tappity,tap …. poyt!}

“Man In The Middle …Janus attack”

Good that you brought up Janus. There is a story of Adam and Eve that had them conjoined back to back. (Should we only be sticking to the more catholic stories of Genesis? There are some interesting little sidetracks off the garden path.)

… and thanks for the pswd!

chigau (無):

November 24th, 2012 at 11:47 pm

Didn’t Plato have some notion of primordial back-to-back entities?
male-male, female-female, female-male
The Gods split them and now we all spend our lives seeking the primordial ‘other half’

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 24th, 2012 at 11:58 pm

@Chigau

Plato recorded it but attributed the story to Aristophanes

chigau (無):

November 25th, 2012 at 12:04 am

Ing
Do you have a link to something online?
I dredged that up out of something I read almost 40 years ago.

theophontes (坏蛋):

November 25th, 2012 at 12:18 am

@ chigau

There are also very old Jewish stories as such. I shall have to dig a little bit. If you are following SGBM and my latest conversation, you might notice:

Janus —> Janitor —> Tor (I raise this point only that you might want to tease the Public Enemy Number One ™ a little.)

@ SGBM

I am mailing this via a browser that has a little green onion in the corner.

John Morales:

November 25th, 2012 at 12:49 am

chigau, you should take a leaf from Theopnontes @468.

That said, Aristophanes’s Speech from Plato’s Symposium.

jonmilne:

November 25th, 2012 at 1:12 am

Specifically, the part I’d like help with is this:

5) More Chimp and Human DNA stuff

Now that the chimpanzee genome has been unravelled…..wait – you didn’t know that it had not been unravelled? Oh – you’ve probably heard the claims made for over a decade now about how humans and chimps share 98.4% of their DNA huh? Yup, such claims were made with very little of the chimpanzee genome actually decoded! It’s like reading one book, then reading the first page of a completely different book and saying the two books were almost identical.
Unfortunately, that analogy holds true in far more ways than one realizes. Not only did the evolutionists who made this claim have very little of the chimp’s “book,” to compare to the human “book,” they ignored huge portions of the parts of the book that they did have!

So last year the chimpanzee genome was finally decoded and made public – yet strangely the evolutionary community was quiet on many aspects of the genome. Presumably because of all the unexpected contradictions to the evolutionary theory that were being discovered.

First of all, coming back to the “Human and Chimpanzee DNA is 98.4% identical” claim, as I mentioned in a previous newsletter (“Meet your relative, the sponge”), we only had an estimate
of the length of the chimp DNA – which was around 10-15% longer than the human DNA. We now know it’s about 12% (you can download, view and compare the DNA sequences of multiple critters here: http://hgdownload.cse.ucsc.edu/downloads.html). So how then can the chimpanzee and human DNA be 98.4% identical when one is 12% longer than the other?

The 98.4% figure (or 99%, depending on who you ask, obviously the number doesn’t matter because it’s ludicrous) was arrived at by ignoring huge portions of each DNA. You have to dig to find this out and get the evolutionary “researchers” to admit this. But it gets worse. To understand this, let’s do a little crash course on DNA and chromosomes.

Crash course in chromosomes:
Chromosomes are bundles of DNA. Humans have 23 pairs of chromosomes, and each chromosome contains unique DNA. Two of the chromosomes are linked to gender, known as the X and Y chromosomes. Women have two X chromosomes while men have one X and one Y chromosome. If you were to unwind the DNA in each chromosome, all of it put end to end makes up your genome, or your entire genetic code (DNA).

Male human chromosomes

The DNA is made up of four chemicals which are represented by letters A, G, C, and T. These four letters in sequence make up the instructions on how to build you. Sequences of these letters contain specific instructions to do specific things (like making an arm for example), and these sequences are called genes.

So now to compare chimp DNA and human DNA, the evolutionary researchers lay the chromosomes of the two critters side by each to see how the letter sequences and genes line up.

In short, they don’t line up.So this is where some rather… ahem creative liberties are taken to make the comparisons. The evolutionary researcher will find the gene that codes for say, the appendix in the human DNA, and they will find the gene that codes for the appendix in the chimp DNA and compare them. While it should come as no surprise that they’re similar, you’ll please notice they have just ignored some 99% of the entire DNA to make one comparison. And all too often that comparison arrives at figures of 98.4% identical – which should come as no surprise to an engineer.

You see, as a robotics engineer, I’ve had people spontaneously say that they can recognize a robot I built by its design. This is because what works on one robot, works on another completely different robot. So I use the same design and parts on different robots. This is efficient design and has nothing to do with one robot evolving into another! This is evidence of a common designer.

The fact that two completely different robots have the exact same gripper would be called a homology, or a homologue.

So yes, you will see homologues in life – we creationary thinkers would say it’s evidence of a common designer, not a common ancestor. In fact, to use the robot analogy some more before we actually compare the chimp and human DNA, let’s say I use the exact same robotic gripper on two robots: One is a land roving robot, the other is a submarine robot. The land rover has the gripper attached to the end of a robotic arm, but the submarine has it attached to the frame, to grab things to hold the robot in place.
So while both robots have the exact same gripper (evidence of a common designer), the location of the gripper is completely different (which is good evidence that one robot didn’t evolve into the other ).

This is, in effect, what we see when we compare the chimp and human genes, and you can look at the comparisons yourself on the ensembl website.

You can get a wonderful tour of what I’m going to talk about here by youtuber Hugenex2000:
http://www.youtube.com/watch?v=Ey5MuAgLWd8&feature=player_embedded

The big chromosome up the middle of the image above is a human Y chromosome. The chimpanzee Y chromosome, for comparison, is in the upper left. The first problem you’ll notice is that the graph actually shows two other chimpanzee chromosomes. Why? Because the gene in the human corresponds to the gene in a chimp on a completely different chromosome!
So not only are the genes different from each other, they are in radically different places – like the robots having a similar gripper in completely different locations. In fact, take a look at the lines connecting the genes from the chimpanzee Y chromosome (upper left) with the human Y chromosome, and you’ll notice that the genes are in completely different locations.
Chimpanzees and humans were supposed to have evolved from a common ancestor, and therefore the genes should be in relatively the same places between the organisms. But they are not even close! The order is completely switched around. This is supposed to be “98.4% similiarity.”

ORFan genes:
Scouting around in ensembl, in the bottom right hand corner, click on “15 downstream genes.” This will list the first 15 genes in the human and chimpanzees.
You’ll notice right off the bat that the first four genes in the human have “no homologues” in the chimpanzee. In other words, these genes are unique to the human. These are called Orphan genes, or ORFan (for Open Reading Frame). Chimps and humans both have hundreds of orphan genes. The orphan genes have a 0% DNA match between humans and chimpanzees – but you never hear about that when the anticreationists cite the similarities between human and chimp DNA as evidence for evolution, do you? That’s because it doesn’t help evolution – in fact, it poses another challenge for evolutionary theory: If evolution works by “descent with modification,” HOW did so many unique genes arise in each species?
This is an especially important question when you realize that a lot of these orfan genes are crucial to the organism’s survival!

Forget cold fusion – we got chromosome fusion!
Just as bogus as the 98.4% similarity claim, some evolutionists have also claimed that the common ancestor of the chimp and human had 24 chromosomes, and two of the ancestor’s chromosomes “fused” together into one chromosome somewhere along our ancestry, which is why humans only have 23 chromosomes.

At the alleged fusion location, it was claimed there were found telomere sequences. Telomeres are at the very end of the DNA chain in a chromosome, and it’s like a marker to show the DNA-reading equipment where the end is, and to protect the DNA from fragmentation at the more vulnerable ends of the DNA. Telomeres are simply thousands upond thousands of repeats of six of those letters that make up the DNA, like this:

CTGAGATCCCGCGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG…

The first telomere sequenece (TTAGGG) is marked in purple, and you can see it repeating in red. This continues on for usually many thousands of repeats at the end of the DNA.

So, the evolutionary community claimed there was a telomere sequence right smack dab in the middle of the human chromosome 2, right exactly where evolution predicted if the two ape chromosomes (named 2A and 2B) had fused.

This claim was promoted quite a bit by theistic evolutionist Dr. Ken Miller, who brazenly promulgated the claim in spite of the evidence against it.

For example: when did this fusion occur? How did the 24 chromosome sperm fertilize a 23 chromosome egg, or vice versa? We’re talking extinction of the species here, so this is obviously an important question that Miller and the fused chromosome supporters have swept under the rug!

Anticreationists are frankly quite cocky with this claim, as can be seen by a video posted as a response to a video I have on my channel, a debate between Laurence Tisdall and Jason Wiles, on the Michael Coren show.
The skeptic’s video is entitled “How to shut up pesky creationists.”
http://www.youtube.com/watch?v=dK3O6KYPmEw&feature=related&fb_source=message

Unfortunately for the skeptic, it doesn’t shut me up, in fact, I’ll be posting my own video response to his video shortly.

Chromosomal fusion zombie – dead long ago, but still wanting to eat yer brains…
Evolution and the chromosomal fusion claim are very much like a zombie: Already dead, walking, and wanting to eat your brains.
Enter Dr. Bergman and Dr. Tomkins, zombie slayers extrodinaire. :)
Their article which came out this fall utterly destroyed the chromosomal fusion claim once and for all. (Journal of Creation, Volume 25, issue 2, fall 2011, “The chromosome 2 fusion model of evolution: re-evaluating the evidence.”)

In that article (and a layman’s article synopsis by Dr. Tomkins), they lay out all the nails with which they seal the coffin of the chromosomal fusion zombie:

There is no telomere at the alleged fusion site:
-at the alleged fusion site there was only found a sequence which was vaguely akin to a telomere sequence, with lots of differences to regular telomere sequences, and it was too short!

The telomere sequence was in the wrong spot:
-there was, however, a very nice “telomere sequence” found waaaay down the DNA chain – far away from the alleged “fusion site”

Nearly every chromosome had a “fusion site”:
-obviously telomere sequences in the middle of a chromosome does not indicate a fusion, because nearly every human chromosome had alleged telomere sequences in the middle of it! Obviously, there’s more going on here than meets the eye.

No corresponding DNA sequences:
-if the human chromosome 2 was the result of 2 ape chromosomes fusing, then there should be sequences on either side of the “fusion site” that match the chimp DNA, right? This was not the case – the DNA sequences on either side were quite different than the chimp sequence.

There’s much more to this subject, but I’m trying to keep this article short and relatively simple. If you want to wade into the technicalities of this fascinating subject, you can look up the references and read until your brain explodes….and the zombie eats your brains….

Some more reading:
http://www.uncommondescent.com/intelligent-design/why-the-chromosomal-fusion-argument-doesnt-wash/

http://ianjuby.org/newsletter/?p=489#5

theophontes (坏蛋):

November 25th, 2012 at 4:07 am

@ A.R

This was going to be inevitable and I have seen it coming for a while. Then yesterday a friend told me that George Lucas took twenty (20) years to get Star Wars together. What with all that high-tech that he needed. I don’t even know if this is true. I just realised it seems far too easy to believe.

So anyway, some good news and some bad news concerning TPM:
The bad news: It would take me forever to put the entire movie together with free software, and by myself.
The good news: Our endeavour will continue, but by getting back to old school basics. Instead of a digital CG tardigrade, we will make do with the real thing. The digital microscope has been purchased today (“pix or it didn’t happen” ). Unfortunately the scientific supplies company is shut on weekends, so I can only get the other bits during the week. But we’ll get there. (Eventually.)

theophontes (坏蛋):

November 25th, 2012 at 4:17 am

@ chigau

The Gods split them and now we all spend our lives seeking the primordial ‘other half’

DNA, chigau, DNA.

@ SGBM

I cannot seem to get youtube working with TOR. (Adobe playing silly again?) I might have to roll back to the previous version.

theophontes (坏蛋):

November 25th, 2012 at 4:29 am

@ John Morales

They could also be facing each other….!

(cicely and blf to stop reading now.)

From Othello:

IAGO
‘Zounds, sir, you are one of those that will not
serve God, if the devil bid you. Because we come to
do you service and you think we are ruffians, you’ll
have your daughter covered with a Barbary horse;
you’ll have your nephews neigh to you; you’ll have
coursers for cousins and gennets for germans.

BRABANTIO
What profane wretch art thou?

IAGO
I am one, sir, that comes to tell you your daughter
and the Moor are now making the beast with two backs.

BRABANTIO
Thou art a villain.

IAGO
You are–a senator.

John Morales:

November 25th, 2012 at 4:36 am

theophontes, is it synchronicity, or have you been reading B&W? ;)

–

Also, the beast with two backs can rearrange itself to have one front and one back.

(Or so I’ve heard)

theophontes (坏蛋):

November 25th, 2012 at 7:18 am

@ John Morales

syncronicity or B&W

Rupert Sheldrake Syncronicity (I did not read her posts prior to posting. I count 4 posts on the opening screen of B&W that relate somehow to my comment above. Wow.)

Muse:

November 25th, 2012 at 10:10 am

jonmilne – I don’t have time to go through the whole thing, but I’ll note they are unclear on the difference between mtDNA and DNA. However talk.origins is a good site to look in for answers.

http://www.talkorigins.org/origins/search.html

strange gods before me ॐ:

November 25th, 2012 at 3:37 pm

theophontes,

I cannot seem to get youtube working

My first guess is NoScript. Gently wiggle some knobs.

Otherwise, type about:plugins into Firefox’s address bar to see if Flash is being recognized. If not, you might have to install a copy of Flash into the bundle. I don’t know, I’m just guessing. (You may want to set about:config plugin.expose_full_path to true.)

In any case, you can use youtube-dl to grab videos — remember to chmod u+x ./youtube-dl — and then watch them in VLC. So for instance you might do:

`env http_proxy=http://127.0.0.1:8118 HTTP_PROXY=http://127.0.0.1:8118 ./youtube-dl --format 34 http://www.youtube.com/watch?v=Cam2kK7J_8k`

I might have to roll back to the previous version.

Next password will have to be less cute, more random.

By the way, if I were you, I would not mention tee oh arr, lest Pharyngula be blacklisted. There’s a reason you already can’t download the bundle without outside assistance.

strange gods before me ॐ:

November 25th, 2012 at 3:52 pm

Oh, instead of Flash, you can try YouTube’s beta of HTML5.

Owlmirror:

November 25th, 2012 at 4:15 pm

By the way, if I were you, I would not mention tee oh arr, lest Pharyngula be blacklisted. There’s a reason you already can’t download the bundle without outside assistance.

Huh.

Is the SF site with that name blacklisted? The site for the SF imprint of Macmillan Publishers USA?

strange gods before me ॐ:

November 25th, 2012 at 4:38 pm

Probably not, if other words on that page aren’t also suspicious.

chigau (無):

November 26th, 2012 at 9:00 am

poke

strange gods before me ॐ:

November 26th, 2012 at 9:14 am

You’ll put someone’s eye out!

chigau (無):

November 26th, 2012 at 9:19 am

I just hate to see this thread just, laying (lying?) there, all dormant an’ stuff.

Dhorvath, OM:

November 26th, 2012 at 9:40 am

It’s easier to keep up this way.

theophontes (坏蛋):

November 26th, 2012 at 9:45 am

Snake!

theophontes (坏蛋):

November 26th, 2012 at 9:47 am

The tardigrades have had their day in court. Tee Oh aRe shall have to wait until the morrow.

chigau (無):

November 26th, 2012 at 9:51 am

It’s easier to keep up this way.

True.
It’s harder to get to page2, though.

theophontes (坏蛋):

November 26th, 2012 at 9:53 am

@ chigau

A mere eight comments to go!

Dhorvath, OM:

November 26th, 2012 at 10:03 am

But what’s on page two?

chigau (無):

November 26th, 2012 at 10:09 am

What’s on page two?
You never know until you get there!

theophontes (坏蛋):

November 26th, 2012 at 10:50 am

@ Dhorvath

Page two is a most wonderfull place, it is like Teh Thunderdome, only more so. It has endless herds of trolls and godbots scampering across the open veld, like so many gazelle on the Serangeti. There are pencil sharpeners under every tree and pointed sticks lie about, too many to count. The rivers are made of lemonade and the piggies roam about ready cooked, with knifes and forks stuck in theirrumps for easy slicing ….

theophontes (坏蛋):

November 26th, 2012 at 10:50 am

@ Dhorvath

Page two is a most wonderfull place, it is like Teh Thunderdome, only more so. It has endless herds of trolls and godbots scampering across the open veld, like so many gazelle on the Serangeti. There are pencil sharpeners under every tree and pointed sticks lie about, too many to count. The rivers are made of lemonade and the piggies roam about ready cooked, with knifes and forks stuck in their rumps for easy slicing ….

theophontes (坏蛋):

November 26th, 2012 at 10:54 am

And everything comes in twos, even the comments…

…

For those waiting to enter the kingdom of heaven page two, I linky some light entertainment: Derren Brown Messiah

chigau (無):

November 26th, 2012 at 10:55 am

There is some weird stuff going on here…

theophontes (坏蛋):

November 26th, 2012 at 11:05 am

@ chigau

The coupe de grace is yours…

chigau (無):

November 26th, 2012 at 11:09 am

If I hurry…

Dhorvath, OM:

November 26th, 2012 at 11:09 am

I have that effect.

chigau (無):

November 26th, 2012 at 11:23 am

I’ve had two comments disappeared this morning.
I wonder what rules they violated?

opposablethumbs:

November 26th, 2012 at 12:28 pm

And a very graceful, gracious and merciful coup de grâce it was too.

chigau (無):

November 26th, 2012 at 4:23 pm

Where are the trolls of yesterthread?

cm's changeable moniker:

November 26th, 2012 at 5:58 pm

There’s a troll on todaythread. Sadly, I’m more inlined to defend than attack it. (It does have a wisp of a point: impact studies don’t inform attribution studies. It’s obnoxious, but not entirely wrong.)

cm's changeable moniker:

November 26th, 2012 at 7:00 pm

Why has my Jean de Florette DVD been snapped? It’s supposed to be an O. Now it’s a C.

Bloody kids. grump

To YouTube!

Owlmirror:

November 26th, 2012 at 7:25 pm

Boingboing sez: Tardigrade is plump, loveable

cm's changeable moniker:

November 26th, 2012 at 7:46 pm

Awww, cute. It’s like a microscopic Huggle Buddy.

(Seriously, they should make a tardigrade one. It would be awesome, even if over-provisioned with feet.)

Owlmirror:

November 26th, 2012 at 9:07 pm

<ha-ha class=Nelson>
NPR’s Science Friday goes after creationist mimic
</ha-ha>

Is Fred Williams the same as yesyouneedmyimaginaryfriend, Enyart’s troll buddy?

I do hope we can add “Convicted IP thief” to Enyart’s “convicted child abuser” rap sheet.

theophontes (坏蛋):

November 26th, 2012 at 10:38 pm

@ Owlmirror

plump

It comes with the territory. Too many client lunches and the like. I have tried not eating rice at such events and cutting out beers during the week. It has worked a bit. Now I must just get around to doing some exercise for a change.

@ cm’s

Clicky. {Aaaaawwwwwwwwww…..}

theophontes (坏蛋):

November 26th, 2012 at 11:50 pm

@ A.R

There is some progress on TPM front: Image of teh tardigrades home. (sadly none could be found in the sample. Auditions will continue until we find a suitable candidate.)

chigau (無):

November 27th, 2012 at 12:17 am

theophontes
google caribou moss

theophontes (坏蛋):

November 27th, 2012 at 12:46 am

@ chigau

caribou moss

Wow, I have a jealous.

My moss comes from the square down near the MTR station. There was an old man slowly picking out the stuff from the cracks between the bricks – with a sharp stick. (A job that will likely be eternal.)

theophontes (坏蛋):

November 27th, 2012 at 3:21 am

@ SGBM

It looks like tor* does not work in China. It gets stuck when looking for …. Linky.

* Teh word above is disguised from spiders bots etc. They would have to look at it visually to pick it up.

John Morales:

November 27th, 2012 at 3:57 am

theophontes, what makes you imagine bots don’t exclude markup?

theophontes (坏蛋):

November 27th, 2012 at 6:45 am

@ John Morales

You better set me right here:

If I type the following:

t o r*

or

Ch i na

Will that not get passed the censors?

theophontes (坏蛋):

November 27th, 2012 at 6:50 am

:ᗡ

John Morales:

November 27th, 2012 at 6:53 am

theophontes, frankly, I don’t know.

… frankly, I don’t know.
… frankly, I don’t know.

(How do you think the above will be indexed?)

theophontes (坏蛋):

November 27th, 2012 at 7:48 am

@ John Morales

(How do you think the above will be indexed?)

Frankly, I don’t know.

(I always simply assume they will weigh my files from time to time and pay me a visit when the dossier clocks in at over 10 kilograms.)

A. R:

November 27th, 2012 at 9:01 am

[A. R begins to set up some strange equipment in the thread. A strange harmonic drone is coming from the large line-patterned metallic sphere at the top.]

This should take care of our troll drought!

theophontes (坏蛋):

November 27th, 2012 at 9:49 am

@ A.R

You picked up on the …er… minor setbacks on set (TPM)?

No Light:

November 27th, 2012 at 11:26 am

cm’s changeable moniker

Why has my Jean de Florette DVD been snapped? It’s supposed to be an O. Now it’s a C.
Bloody kids. grump
To YouTube!

My sympathies. They have good taste though, and were clearly fighting over who loves it most.

When I was a little No Light, a mere flicker of darkness, my dad had a collection of singles and albums from the sixties, it was his pride and joy. It was kept in an old sideboard in my room, as it was the biggest bedroom.

When I was five I found them, during some “sent to my room for a nap” boredom. First thought? “OMG FRISBEE!” Second thought “Get Mini Minion 3 year old brother from his room. Nap time is over!”

Aaand we spent the next hour playing frisbee with Beatles albums and Hollies records, and all sorts of shiny round things and their sleeves.

By the time we were apprehended the records were pieces of shellac and vinyl. Only the cardboard ones were still playable. I still feel fucking awful about it! I still remember the look on his poor face.

DVDs are pretty strong though. If only CDs or DVDs had been around then.

jonmilne:

November 27th, 2012 at 1:13 pm

Okay, different debate I’m having. This one is about secular morality. Basically what happened is I had this guy called Bryan email me and ask me what evidence there was that secular morality was an better than religious morality. I pointed him towards this study at http://www.pitzer.edu/academics/faculty/zuckerman/Zuckerman_on_Atheism.pdf as well as the summary here, and concluded:

“The point here should be obvious: if the constant claim made that “religious people are intrinsically more moral than atheists” actually held any water, then we should see across the board evidence that in all aspects, religious people should score better than secular minded people. And yet we don’t. In fact, not only do we not see any actual difference between believing in a God and not believing in one, but in many actual aspects, secular atheists actually are the ones who score better. Kinda revealing, surely?”

Bryan responded like this.

Jon,
Correlation does not prove causation UNLESS you find a causal mechanism. Atheism has no morals of its own at all. All it has it borrowed from other views, usually Christianity.

The main reason why some secular nations are doing better in a number of areas is due to economics. They are following principles of economic justice outlined in the Bible long ago, while America is not.

Korea is the most Christian nation in Asia and the #2 mission sending nation in the world at present. It’s also scored #1 in reading, science and math. It ALSO has a much more biblical concept of economics, guaranteeing public health care cheaply for all, having much more of a concern for the government meeting the basic needs of all (which greatly reduces crime, terrorism, war, societal instability, as well as abortion incidentally).

There are many factors that influence morality. But, religion is indisputably one VERY big one.

INCREDIBLE STORY! Former White Supremacist Skin Head neo-nazi Gives Life to Jesus
http://www.godtube.com/watch/?v=0B1JMJNU

God Revolutionizes lives
http://www.youtube.com/user/truthislife7#g/c/0361CAE3DB6FE0D5

————-
RESEARCH
————-
Belief in God Improves Prosocial Behaviour (moral behaviour) In 186 Societies.
Roes & Raymond (2003) found that across a sample of 186 human societies, belief in watchful, moralizing gods was positively correlated with measures of group cohesion & size. In addition, experimental research reveals that even subtle reminders of God & religion also promote prosocial behavior (e.g., Pichon, Boccato, & Saroglou, 2007; Randolph-Seng & Nielsen, 2007; Shariff & Norenzayan, 2007; see also McKay, Efferson,Whitehouse, & Fehr, 2011).

CHRISTIANITY IMPROVES THE MORALS OF SOCIETY
Large research studies have shown that Christianity helps improve morals in young people (and the same is true in older people).
http://www.godandscience.org/apologetics/religion_as_child_abuse.html

ATHEISTS AGREE CHRISTIANITY IMPROVES MORALS
Dr. Guenter Lewy professor emeritus of the Univ. of Massachusetts was a secularist who set out to ridicule the claims of Christians that the crisis of the age is a crisis of unbelief and to prove the attack on secular modernity “to be a danger to individual liberty as well as an affront to people of goodwill who happened to be agnostics or atheists.” He intended to write a book “Why America doesn’t need Religion.” But, the research changed his mind and he wrote the book, “Why America Needs Religion.”

“The fifth chapter, “Religiousness and Moral Conduct: Are Believing Christians Different?,” [asks] the question of whether the Christian faith transforms the lives of those who take their religion seriously. In particular, Professor Lewy examines the questions of juvenile delinquency, adult crime, prejudice and intolerance, single parenting, and divorce, and concludes that the vast majority of social science research supports the finding that the minority of Christians who take their religion seriously (as opposed to the nominal Christians of the Christmas-and-Easter variety) have significantly lower rates of moral failure and social ills than any other groups studied.
http://www.acton.org/pub/religion-liberty/volume-7-number-5/why-america-needs-religion

You can read much of this chapter online. Start on about page 95.
http://books.google.com/books?id=KfxJA_7zG7MC&pg=PA89&dq=Why+America+needs+God&hl=en&ei=tD5LTp2iMo_JmAXXqo3jBw&sa=X&oi=book_result&ct=result&resnum=1&ved=0CCwQ6AEwAA#v=onepage&q&f=false

See also:
http://www.youtube.com/watch?v=nIn3cu5mdGY
http://www.leaderu.com/ftissues/ft9704/reviews/budziszewski.html
http://www.acton.org/sites/v4.acton.org/files/pdf/rl_v07n5.pdf (pg. 12 & 13)

Some allege that Christians have killed people and committed other crimes. This has unfortunately happened in some cases. In nearly all of these cases, the Christians were disobeying the Bible. Should we get rid of science because some scientists have built bombs, chemical weapons and because some like Josef Mengele have done horrible experiments? No. That would be stupid. Should we get rid of education because some teachers have broken the rules and abused kids? No, that also would be foolish. We cannot condone the wrong behaviors of some Christians, but just like the above cases, it would be extremely foolish and harmful to reject Christianity because of some who are disobeying its principles or misunderstanding it.

If we must look at how many people died though, the fact is that atheist states have killed ~30 times more than ALL religions in history and this includes all religions that are unbiblical (Hinduism, Islam, Voodoo, Catholicism, etc.)
http://www.godandscience.org/apologetics/atrocities.html

So yes, as much help as possible in tackling this stuff would be really really appreciated.

Much thanks,

Jon Milne

keresthanatos:

November 27th, 2012 at 1:13 pm

(thresproing thunk)…..damned troll magnets…..somebody cut that thing off.

A. R:

November 27th, 2012 at 2:39 pm

theophontes: Yes, I did. I would remind you that the commander of the LOLstar does not like to be disappointed…

nigelTheBold:

November 27th, 2012 at 4:33 pm

Hey, folks. I have lured a certain joe4060 from Greta’s blog over here, as our discussion was way off-topic. I ask that y’all treat ‘em with courtesy and allow us to hold a debate here.

I’m pretty damned buzzed, but I’m quite sure I can hold my own.

nigelTheBold:

November 27th, 2012 at 4:47 pm

joe4060:
(Continued from Greta’s blog:

Thunderdome? Looks more like a two-man tent; but I will give it a go.

P.S. Your admission that you don’t know the origins of information and the DNA molecule renders the claim that evolution is a proven fact, false, and therefore much of what is in Greta’s book is also false.
Evolution has to be believed by faith, which makes it just another religion.
Science itself has been turned into “God” or an idol of man’s own invention.

Actually, if you’d bothered to attempt an understanding of what I wrote, I stated the origins of information. Did you not read that? Information is the set of relationships between physical things. It’s really as simple as that.

The fact I don’t know the origins of the DNA molecule itself has no bearing on the validity of the theory of evolution through natural selection. Those two issues are orthogonal. Abiogenesis is its own field; what happened after is another. The “what happened after” we like to call, “The theory of evolution through natural selection.” Or at least, I do.

Now, since the theory of evolution through natural selection (or just “evolution,” from here on out) made specific predictions that have all turned out true — some of them pretty astounding predictions — how is it you declare the theory of evolution not accurate?

Evolution is not believed by faith, no more than the theory of gravity is believed by faith. It’s accepted because of its predictive powers. It predicted an information substrate, like DNA. Evolution, coupled with geology, predicted the location of tiktaalik. Evolution predicts the relative rate of mutations between generations, leading to specific predictions concerning the differences between non-coding regions of related species — predictions which turned out to be accurate.

No. Evolution is not taken on faith. Evolution is accepted as the best descriptive model of adaptation of life through time. And it’s accepted because of its predictive power.

Evolution has so far provided the best predictive power of all models of the adaptation of life through time. If you have a better, more accurate model, I’d be happy to entertain it.

nigelTheBold:

November 27th, 2012 at 5:02 pm

joe4060:

Actually, please ignore the previous post for the moment. There’s something far more pressing to be worked out here.

What exactly do you think science is?

vaiyt:

November 27th, 2012 at 5:38 pm

P.S. Your admission that you don’t know the origins of information and the DNA molecule renders the claim that evolution is a proven fact, false,

This is looking at things the wrong way.

The Theory of Evolution is a description of things that happen, and how they happen the way they do.

We don’t know exactly what came before DNA, big whoop. We don’t need to know where gravity came from to assess that the Theory of Gravity is accurate. We don’t need to know what came before atoms to understand how atoms work.

The circumstances of something’s creation only matter for the why, not the how.

cm's changeable moniker:

November 27th, 2012 at 6:17 pm

A. R, elsewhwere:

“cut the mustard” (by the way, anyone have a clue as to what the etymology of that phrase is? Because I’m rather curious.)

Brewer’s sez (in its usual frustrating style):

Mustard [...] Cut the mustard, To. See under CUT.

sigh flip flip flip

Cut the mustard, To. To do something well and efficiently, especially when it is supected that one may lack the ability. The expression derives from ‘mustard’ as a slang word for a thing that is the the best, and O. Henry has a character in his Cabbages and Kings (1894) say: ‘I’m not headlined in the bills¹, but I’m the mustard in the salad just the same.’ The ‘cutting’ refers to the act of harvesting the plant, i.e., garnering the best.

Perhaps I could get a job as a maid in somebody’s house … Idden convinced me I would never cut the mustard at this occupation.
JESSICA MITFORD: Hons and Rebels, ch ix (1960)

¹ This is “bill” in the sense of “list of people performing at the music hall”.

And now I will be up all night reading weird stuff in Brewer’s because, well, that’s what it’s for. ;-)

joe4060:

November 27th, 2012 at 9:28 pm

nigelthebold

Science is simply a limited tool (like philosophy, mathematics etc.) that is used as a means of discovering how things work by means of repeatable and falsifiable tests in order to predict how things in the physical world will behave.
Its power to accuratly show what happened during one-off past events such as the origins of life fall outside of its scope and function. I.e. it cannot predict what happened in the past.

Accurate descriptions of one-off historical events can only come from eyewitness accounts (like the Bible).
While science has its place and can be an aid in validating bits and pieces of the historical account; used on its own it is completely inadequate; like using the wrong tool for the wrong job.

Your origins of information relies on physical matter, whereas information is non-physical i.e. meta-physical like our thoughts.

Because science on its own cannot test or repeat a one-off event from the past (the big bang or creation) any account of history that is patched together from it can in no way be accurate since so many different things have occured between the beginning and now (changed conditions).
That’s why an account of history based on scientific endeavour, such as evolution, has to be taken in faith (‘accepted’ and ‘faith’ are the same thing) because there is no eyewitness account to verify exactly what really did occur; it is largely based on speculation and interpretations that fit evolutionary thinking.

Because evolutionists put their faith in science (which is of itself lifeless), it becomes their ‘god’ or idol.

The idolatrous, destuctive core that is found in evolution has been around for a long time and can be seen in some of its policies and agenders (universal indoctrination) and can be plainly seen manifested in todays society e.g. abortion.

They served their idols, which became a snare to them. They even sacrificed their sons and daughters to demons, and shed innocent blood, even the blood of their sons and daughters, whom they sacrificed to the idols of Canaan. Psalm 106: 36, 37

Abortion is nothing more than sacrificing children to the devil; the same thing for which societies in the past were destroyed by God’s wrath.

John Morales:

November 27th, 2012 at 9:45 pm

joe4060, your erudition awes me.

Tell me, O wise one, how many Philistine foreskins did David give to Saul, 100 or 200?

joe4060:

November 27th, 2012 at 9:51 pm

vaiyt

What caused the atoms, which are without intelligence, to assemble themselves into something intricate and complicated enough to contain life?

Gravity is gravity; it is dead. Where did LIFE come from?

Caine, Fleur du mal:

November 27th, 2012 at 9:51 pm

Accurate descriptions of one-off historical events can only come from eyewitness accounts (like the Bible).

The bible contains no eyewitness accounts. It’s a bad exercise in storytelling. Even if it did contain eyewitness accounts, it would be next to meaningless. Eyewitness accounts are notoriously inaccurate.

Abortion is nothing more than sacrificing children to the devil

You’re quite the silly idiot. A fetus is not a child and abortion has nothing at all to do with a fictional devil.

the same thing for which societies in the past were destroyed by God’s wrath.

Wrong again! That sadistic, sociopathic god of yours had nothing at all against slaughtering pregnant women, nor did it have any problems with infanticide or the slaughter of children in general. Did a whole lot of it.

Happy shall he be, that taketh and dasheth thy little ones against the stones. — Psalm 137:9

And ye shall eat the flesh of your sons, and the flesh of your daughters shall ye eat. — Leviticus 26:29

And thou shalt eat the fruit of thine own body, the flesh of thy sons and of thy daughters. — Deuteronomy 28:53

And I will cause them to eat the flesh of their sons and the flesh of their daughters, and they shall eat every one the flesh of his friend. — Jeremiah 19:9

And he went up from thence unto Bethel: and as he was going up by the way, there came forth little children out of the city, and mocked him, and said unto him, Go up, thou bald head; go up, thou bald head. And he turned back, and looked on them, and cursed them in the name of the LORD. And there came forth two she bears out of the wood, and tare forty and two children of them. — 2 Kings 2:23-24

The LORD smote all the firstborn in the land of Egypt, from the firstborn of Pharaoh that sat on his throne unto the firstborn of the captive that was in the dungeon…. And there was a great cry in Egypt; for there was not a house where there was not one dead. — Exodus 12:29-30

And he said, Take now thy son, thine only son Isaac, whom thou lovest, and … offer him there for a burnt offering…. And Abraham stretched forth his hand, and took the knife to slay his son. — Genesis 22:2,10

The eye that mocketh at his father, and despiseth to obey his mother, the ravens of the valley shall pick it out, and the young eagles shall eat it. — Proverbs 30:17

If a man have a stubborn and rebellious son, which will not obey the voice of his father, or the voice of his mother, and that, when they have chastened him, will not hearken unto them: Then shall his father and his mother lay hold on him, and bring him out unto the elders of his city, and unto the gate of his place; And they shall say unto the elders of his city, This our son is stubborn and rebellious, he will not obey our voice; he is a glutton, and a drunkard. And all the men of his city shall stone him with stones, that he die: so shalt thou put evil away from among you; and all Israel shall hear, and fear. — Deuteronomy 21:18-21

He that smiteth his father, or his mother, shall be surely put to death. — Exodus 21:15

He that curseth his father, or his mother, shall surely be put to death. — Exodus 21:17

hyrax:

November 27th, 2012 at 10:01 pm

Hey all. This is super off topic for anything– I see you’ve found a shiny new chew toy and the squeaker hasn’t even been broken yet! But I’m a near-total lurker and I just need to rant for a minute, and since said rant concerns a poster on another thread, I figured here was the place. Right?

So…
noelplum99 has been, increasingly throughout this thread, been reminding me of the guy who raped me. Said rapist was a “friend” of mine, and something about noelplum’s syntax and attitude is really wigging me out. Rapist was a “skeptic” and an “intellectual” who “respected women.” (Funny how he had a hard time respecting the word “no.”) In fact, he would go to great lengths to talk about how much he loved and respected women as equals and how progressive and liberal he was, and yet would still bring up bullshit evo-psych biological arguments about things like military service. Now, I know that noelplum isn’t the same guy– his youtube videos confirmed that for me!– and I’m certainly not accusing him of being anything other than a douche who’s in love with his own bad arguments. This is more just by way of explaining that, fuck’s sake but I so fucking sick that particular flavour of bullshit intellectual dishonesty.
(Also, perhaps, a note that triggers can sometimes be found where you least expect them.)

Anyway… scans back upthread

Accurate descriptions of one-off historical events can only come from eyewitness accounts (like the Bible).

Bwah ha ha ha ha ha! wipes eyes Oh, man, I needed that. Priceless.

Caine, Fleur du mal:

November 27th, 2012 at 10:14 pm

Hyrax:

This is more just by way of explaining that, fuck’s sake but I so fucking sick that particular flavour of bullshit intellectual dishonesty.

You, me and most everyone else here. I am so sorry you were triggered by his waterfall of shit. No one needs that and it just goes to show that such attitudes and beliefs continue to do active harm.

joe4060:

November 27th, 2012 at 10:15 pm

John Morals

caine, fluer du mal

If reading the Bible upsets you then don’t read it.

But if you change your mind and decide you want to become more knowlegeable on the subject, you could always read: IS GOD A MORAL MONSTER? Making sense of the Old Testament God, by Paul Copan.

John Morales:

November 27th, 2012 at 10:25 pm

joe4060, no, seriously!

Was it 100 or 200 foreskins of slain enemies that was the price for a man’s daughter?

(What does Samuel the eyewitness say?)

hyrax:

November 27th, 2012 at 11:03 pm

Er…

but I am so fucking sick of that particular flavour of bullshit

Seems I missed a few words there. Can you tell I was a tad emotional? Anyway, I don’t blame him for inadvertently triggering me, any more than I would a random man on the street with a particular haircut. But neither does it make me eager to give the time of day to anything else he might write. I’ve had enough of “No of course women should be equals, I just think they’re too important to risk in hard physical labor!” Bleh.

I’m glad I de-lurked just in time to watch the takedown of a bible-thumper! makes popcorn

theophontes (坏蛋):

November 27th, 2012 at 11:05 pm

@ No Light

“OMG FRISBEE!”

OMG, SNAP!

My brother and I did exactly the same thing. Only, we were older and (I pressume) stronger. We lived on a steep hill and frisbee’d the LP’s as far as we could, out over the valley. They travel quite ridiculous distances before going into a vertical nosedive, developing an interesting wobble and then exploding into shards on the neighbours roof. (We were dreadful children. I have been eBil for a long time.)

@ A.R

{theophontes reads A.R’s missive for a second time, noting element of implied subversion. Sends copy to Minitrue for further investigation of probable thoughtcrime. Leans back in leather armchair. Clicks clawtips together in deep thought:”mmmh… what the tardigrade giveth the tardigrade can taketh away…”}

nigelTheBold:

November 27th, 2012 at 11:07 pm

joe4060:

Science is simply a limited tool (like philosophy, mathematics etc.) that is used as a means of discovering how things work by means of repeatable and falsifiable tests in order to predict how things in the physical world will behave.

Okay. I’m with you so far.

Actually, let me expand on something you’re touching on here.

Science at its most fundamental is philosophy. Specifically, it’s one school of the philosophical branch of epistemology, or the study of how we know things. This is important to understand — how you know something is just as important as what you know. Otherwise, you can’t be sure if what you know is in any way true.

(Or, as I like to say, “Congruent with reality.” Truth can be slippery sometimes, but congruence with reality is not.)

Its power to accuratly show what happened during one-off past events such as the origins of life fall outside of its scope and function. I.e. it cannot predict what happened in the past.

Well, of course not. You don’t predict what happened in the past. Prediction is a time-domain function in the positive direction. You can only predict things that haven’t yet happened. (Now, you might predict what someone is about to reveal; but you cannot predict what someone has already done.)

What science does for things that happened in the past is reconstruction. This is no different from what a forensic investigator does at the scene of a crime. This is based on a simple concept: things that happened in the past affect the world around them. Discovering these effects allows you to reconstruct (partially or completely) the events that caused the effects in the first place.

Accurate descriptions of one-off historical events can only come from eyewitness accounts (like the Bible).

You have three fallacies going on here. The first is that historic events can only be reconstructed via eyewitness accounts. The second is that eyewitness accounts are accurate. The third is that the Bible is an eyewitness account.

Let’s deconstruct these fallacies one by one.

First, anything that happens of significance leaves a trace. When solving a mystery, these are called clues. When prosecuting a crime, they’re called evidence. When using science to untangle historic happenings, they’re called data. All of these things are the same: they are changes that occur due to specific events. A meteor impact will leave a crater. A large meteor impact will leave a thin layer of iridium scattered over the world. And so on. The important thing to realize is this: it doesn’t take an eyewitness to leave clues. Ergo, we don’t have to rely on eyewitnesses to reconstruct what happened.

Second, eyewitnesses are historically very poor at relating actual events. From identifying the wrong person to actually relating events that couldn’t possibly have happened, eyewitnesses are notoriously bad at providing accurate information about an event. In any court of law, physical evidence (that is, things that exist only because of an event) is far better at providing a solid conviction than eyewitness accounts. That’s because physical evidence isn’t subject to the biases and poor perception and even poorer recall of humans. Physical things simply exist.

Third, the Bible doesn’t even present itself as an eyewitness account, so it’s curious you’d present it as such. The Bible pretends to be nothing more than it is: a collection of tribal myth and oral tradition, written down many years after-the-fact. There’s no eyewitness there, and the Bible doesn’t even attempt to claim first-hand knowledge of the events it describes. Genesis doesn’t claim, “I am God, and I am writing this down as I do it.” In style and substance, it pretends to be just what it is: someone writing down an origin story after-the-fact. (Actually, two origin stories. Genesis I and Genesis II present two divergent accounts of creation.)

So your claim that the Bible is an eyewitness account of anything is a curious thing. Biblical scholars don’t claim the Bible is an eyewitness account. The Bible itself doesn’t claim to be an eyewitness account. Who are you to claim the Bible is an eyewitness account?

(Or I could simply ask, “Where you there when the Bible was written? No? So how do you know it’s an eyewitness account if there were no eyewitnesses to the writing? Maybe somebody just lied.”

(But that’d just be mean.)

Your origins of information relies on physical matter, whereas information is non-physical i.e. meta-physical like our thoughts.

Uhm, I didn’t present the origins of information. I presented the nature of information. Information relies on the relationships between different bits of matter, yes. Why do you think your thoughts are any different? Your thoughts are reliant on your brain, and your brain is physical. The electro-chemical differentials in your brain are the relationships that define your thoughts. Why do you think your thoughts aren’t constrained by the physical?

Because science on its own cannot test or repeat a one-off event from the past (the big bang or creation) any account of history that is patched together from it can in no way be accurate since so many different things have occured between the beginning and now (changed conditions).

But that’s a fallacy. Science can indeed test on-off events from the past, as those events leave traces of themselves on the present. (I mean, otherwise, we wouldn’t even wonder about them, as there’d be nothing to wonder about.)

Let’s take the Big Bang for example. The whole hypothesis of the Big Bang is constrained by many things we do know, such as the laws of gravity, general and special relativity, quantum mechanics, and so on. These pieces of knowledge, coupled with observation, are what led us to hypothesize the Big Bang in the first place. The hypothesis of the Big Bang makes certain predictions that must be true for the Big Bang to be an accurate model of the genesis of our universe. We already knew all the galaxies were moving away from us — that’s what led us to the Big Bang in the first place. But, what we didn’t know was the specific nature of the universe background radiation. For the Big Bang to be an accurate model, a certain amount of background radiation would have to exist today — because of the physical evidence left by the Big Bang.

And when we searched for it because of that specific prediction, we found it.

So yes. We can test our models of one-off events against what we observe today, because the very nature of those one-off events affect the reality we observe. Just as your life leaves a mark on the world, so does an almost-infinitely-greater event leave an almost-infinitely greater mark on the universe.

That’s why an account of history based on scientific endeavour, such as evolution, has to be taken in faith (‘accepted’ and ‘faith’ are the same thing) because there is no eyewitness account to verify exactly what really did occur; it is largely based on speculation and interpretations that fit evolutionary thinking.

“Accepted” and “faith” are not the same thing. “Faith” is the acceptance of a thing without evidence. By their very definitions they are different.

Evolution doesn’t have to be taken on faith. As I have pointed out several times, evolution has made specific predictions, some quite astounding (the existence of DNA, for instance). Those predictions have turned out to be true. Therefore, we have evidence to support the idea that evolution is an accurate model. No faith required.

All scientific concepts start off with speculation. That speculation must fit current data. Then, that speculation must predict something unknown, something specific. At that point, the speculation can be called an hypothesis. But until it predicts something we don’t yet know, it’s nothing but speculation.

The theory of evolution through natural selection predicted many things. From DNA to the statistical variance of non-coding DNA between various relatives, to the specific location of tiktaalik fossils, the theory of evolution has withstood the tests we have thrown at it. Modern biology wouldn’t even make sense without it.

Because those predictions turned out to be correct, evolution through natural selection graduated from being an hypothesis to being a theory — that is, an hypothesis that is very much supported by evidence.

Because evolutionists put their faith in science (which is of itself lifeless), it becomes their ‘god’ or idol.

Hogwash.

Science (coupled with logic and mathematics) is so far the only epistemology that has allowed us to advance our knowledge. Any reliance on science (heh — I’m a poet) is necessity, not faith. Scientists might trust that science is a reliable tool, but that’s no more faith than a carpenter puts in her hammer. You attempt to bring science down to the level of religion — but that simply underscores the inferior position of religion in the realm of epistemology. You certainly have not diminished the importance of the epistemology of science, nor the tools which it spawned, the scientific method.

I’m curious why you called out science as being “lifeless” though. That’s an odd phrase to place right there, as if the veracity or effectiveness of the scientific method were somehow contingent on it being alive.

That’s just… odd.

The idolatrous, destuctive core that is found in evolution has been around for a long time and can be seen in some of its policies and agenders (universal indoctrination) and can be plainly seen manifested in todays society e.g. abortion.

That’s a complete and utter non sequitur. Abortion has nothing to do with science. You’re confusing the realm of what is (the realm of science) and the realm of what should be (the realm of ethics).

Science is nothing more and nothing less than a tool for prising the secrets of reality. It does this by comparing what we think we know against what is. In this way, we are constantly testing our assumptions against reality.

Religion, on the other hand, actively discourages this. You are a prime example of the way religion discourages the comparison of what you think you know to what really is. Your religious background causes you to assume the Bible is correct, and no amount of reality will change that. No matter how many times biologists demonstrate evolution in action, no matter how many times the background radiation indicates a period of initial inflation (“Big Bang,” as folks like to call it), no matter how many galaxies are inexplicably billions of light-years away (shattering any pretense of a 10,000 year old universe), you will ignore it.

Your understanding of science is not just incomplete, it’s corrupt. You don’t understand the basic nature of science, and so you don’t understand how science works. Yet you feel competent to claim it is ineffective.

At this point, I suspect I know more about your Bible than you do about science. That rather leaves you at a disadvantage.

I’d like to make a suggestion: we don’t move forward until you demonstrate a competence with the epistemology and practicality of science, and I can demonstrate a working knowledge of your theology.

Because until then, you’re not really ready to assess scientific claims at all, and I’m not likely to understand why.

Owlmirror:

November 27th, 2012 at 11:08 pm

Accurate descriptions of one-off historical events can only come from eyewitness accounts (like the Bible).

So… basically an “eyewitness account” is whatever you say is an eyewitness account, right?

You’ve declared yourself to be the sole arbiter of what is and is not true?

Why, exactly, are you arguing then? I mean, if you’re absolutely certain that you’re the sole arbiter of truth, we cannot convince you that you’re not the sole arbiter of truth, because you’re absolutely certain that you are the sole arbiter of truth.

But you can’t convince us that you’re the sole arbiter of truth, because your say-so is worth no more than that of any other fallible human.

So why don’t you just toddle off to church to pray?

Caine, Fleur du mal:

November 27th, 2012 at 11:22 pm

Nigel:

Third, the Bible doesn’t even present itself as an eyewitness account, so it’s curious you’d present it as such.

It isn’t at all curious if Joe follows Ken Ham’s teachings or those of someone similar in thinking. Ham is very hot on the bible being an eyewitness account.

nigelTheBold:

November 27th, 2012 at 11:28 pm

Caine:

It isn’t at all curious if Joe follows Ken Ham’s teachings or those of someone similar in thinking. Ham is very hot on the bible being an eyewitness account.

I know. I’m used to seeing idiocy like that from Ken Ham. I just wanted joe4060 to address the question directly, so we could get that out in the open and talk about it. It’s not like I can confront Ken Ham on the matter.

Yeah. “Eyewitness account” my patriarchal privilege.

Owlmirror:

November 27th, 2012 at 11:49 pm

If reading the Bible upsets you then don’t read it.

If reading about abortion upsets you, then don’t read about abortion.

Of course, your response is an odd (but typical for theists) non-sequitur. The citations from the bible were not offered because Caine found them upsetting, but because they demonstrate that your implicit claim — that God and/or the Bible don’t support killing the innocent — is false.

God does kill the innocent, and command that the innocent be killed.

But if you change your mind and decide you want to become more knowlegeable on the subject, you could always read: IS GOD A MORAL MONSTER? Making sense of the Old Testament God, by Paul Copan.

It’s easy to make sense of the Old Testament God: That God’s behavioral code, as demonstrated in the Old Testament, is “might makes right”.

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 27th, 2012 at 11:53 pm

If reading the Bible upsets you then don’t read it.

ME reading the bible doesn’t upset me. It’s knowing others do uncritically.

Much like Mein Kamf

Caine, Fleur du mal:

November 28th, 2012 at 12:18 am

If reading the Bible upsets you then don’t read it.

Oh my, you’re dense. It doesn’t upset me in the least. The verses I quoted were to refute your nonsense about god loving children. That god of yours is seriously into killing kids, women and has zero problems with collateral damage, whether minor or massive.

But if you change your mind and decide you want to become more knowlegeable on the subject, you could always read: IS GOD A MORAL MONSTER? Making sense of the Old Testament God, by Paul Copan.

Cupcake, back in the day, I did 10 years of in-depth bible reading and study – different versions of the bible and different languages. I can state with a fair amount of confidence that I know it better than you do. I can suggest some reading for you too, assuming you have the courage to read it: Drunk With Blood, God’s killings in the Bible by Steve Wells.

Caine, Fleur du mal:

November 28th, 2012 at 12:24 am

Oh and Joe, here’s a bit more of that “loving” sociopath you think so highly of:

I will make mine arrows drunk with blood, and my sword shall devour flesh; and that with the blood of the slain and of the captives, from the beginning of revenges upon the enemy. -Deuteronomy 32:42

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 28th, 2012 at 12:30 am

Or see I would just suggest “The Bible”

John Morales:

November 28th, 2012 at 12:38 am

Well, I know I’m cool: I like my meat well-done (and the Jawa likes its pleasing odor) and anyway, Jesus died for my sins which are perforce automatically forgiven.

(Actually, I guess I should really go and sin some more, to make his sacrifice to himself worthwhile; wouldn’t want to waste it, would I? ;) )

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 28th, 2012 at 12:39 am

@JM

That was Rasputin’s philosophy and while I haven’t gotten to the end of that biography I’m assuming everything turned out great for him.

John Morales:

November 28th, 2012 at 12:49 am

I seen eyewitnesses telling about Rasputin.

No Light:

November 28th, 2012 at 12:52 am

@Theophontes – CDs just aren’t as satisfying to throw, are they? Too small, too light, the hole in the middle is too big.. Junk.

Joe4060.

Accurate descriptions of one-off historical events can only come from eyewitness accounts (like the Bible).

Which version of the Bible provides the most accurate description, and how?

Are any of the Old Testament Pseudepigrapha and New Testament Apocrypha essential to our understanding of events?

Who witnessed The Fall?

Why does Adam spend 40 days in the river Jordan?

Is merkabah still relevant to your understanding of the bible?

If Yahweh created Adam and Chava as the first humans, who did their sons (Abel, Cain and Seth) marry?

Thanks in advance!

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 28th, 2012 at 12:58 am

And who was Cain protected from by his mark when he was banished?

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 28th, 2012 at 12:58 am

as a side note the “Mark of Cain” being a curse really really irks me (especially YOU mormons). It totally frelling isn’t, it’s a ward of protection.

John Morales:

November 28th, 2012 at 1:15 am

Kane’s mark is his blue eyes’ killer’s gaze.

Owlmirror:

November 28th, 2012 at 1:32 am

Huh.

The cites @#33/#533 don’t even include Numbers 31.

Verse 9: And the children of Israel took all the women of Midian captives, and their little ones, and took the spoil of all their cattle, and all their flocks, and all their goods,

Verses 15-17: And Moses said unto them, Have ye saved all the women alive? Behold, these caused the children of Israel, through the counsel of Balaam, to commit trespass against the LORD in the matter of Peor, and there was a plague among the congregation of the LORD. Now therefore kill every male among the little ones, and kill every woman that hath known man by lying with him.

Tony ∞2012 recipient of the coronal mass erection∞:

November 28th, 2012 at 1:54 am

Drat. I must have dozed off and missed the Creationist Alarm Bell. I was just about to go to bed. Think I will go pop some popcorn and watch you folks work off the stress of finally being fed.

Caine, Fleur du mal:

November 28th, 2012 at 2:06 am

Owlmirror:

The cites @#33/#533 don’t even include Numbers 31.

There wasn’t room for them all. The OT is basically one long recitation of various killings, torture and assorted sadism.

I left out so very much. There’s Jephthah, who murdered his daughter ’cause he promised god (Judges 11.39) and god being displeased with David murdering Uriah, so to punish him, he had David’s wives raped and decided that the child born unto David and Bathsheba had to die. Not right away, of course. God made the baby very sick for seven days. After David prayed and fasted for the baby, god went all merciful like and killed the kid. 2 Samuel 12.15-18

Then there’s god killing the son of Jeroboam – 1 Kings 14.17 and the killing of Ahab’s sons, 70 of them – 2 Kings 10.7 and Jehoram’s sons – 2 Chronicles 22.1 and the list just goes on and on and on and on in the murder book.

Tony ∞2012 recipient of the coronal mass erection∞:

November 28th, 2012 at 2:13 am

Hyrax:
I’m so sorry NOELPLUM99 triggered you. He is such an ass.
I offer my sympathies.

Also, I may be late to the creationist beat down, but I did just pop some popcorn (not kidding), so you are welcome to share. The bowl is big enough. I think the denizens of the Thunderdome figured out how to transmit food and stiff drinks across the ‘net :)

Janine: Hallucinating Liar:

November 28th, 2012 at 2:23 am

Gravity is gravity; it is dead. Where did LIFE come from?

Does this person understand the meaning of words?

joe4060:

November 28th, 2012 at 4:22 am

Since a misunderstanding of God’s nature seems to be the main problem here I will explain some things.

Why bad things happen

The reason why bad things happen is not because God does not love us, or that he does not care, but because from Adam onwards we have largely wanted to live autonomously, without him, so he has let us experience this. But as history demonstrates, human wisdom and foresight alone are completely inadequate when dealing with life’s challenges; problems don’t get solved, they only multiply and get out of control (made aditionally worse by flow-on from negative things sown in the past).
The fact that we can’t understand why people die in wars and plagues only demonstrates our sinful, ignorant and blind condition, and that we cannot see that God always minimizes, or only allows the lesser evil to prevail, or the world would be in a far worse state than it is.
God has the devil on a leash, otherwise, given his nature the devil would have burnt the world down long ago.

God will use a smaller evil to inoculate against a larger evil, a small war or diaster (that is happening or about to happen anyway) to prevent a much larger one.
So the devil can only ever be God’s slave, and overall, evil is the servant of good; for example…

And lest I should be exalted above measure by the abundance of the revelations, a thorn in the flesh was given to me, a messenger of satan to buffet me, lest I should be exalted above measure. 2Corinthians 12:7

…(to protect Paul from vanity and pride). God uses the devil’s own weapons against him.

God will always cause the optimum conditions that ensure the salvation of as many people as possible. In his eyes, our eternal salvation has far greater priority than temporary and fleeting happiness. Everything is to serve and contribute to our salvation, whether good or bad.
He uses hardship and adversaries to get our attention and to humble our sinful, arrogant, rebellious, stuborn natures.
But we should also be aware that much of this goes against his good, kind and loving nature and actually demonstrates the lengths he will go to rescue us from sin and eternal damnation.

“God uses the evil angels. They, of course, desire to ruin everything; but God blocks them unless a well-earned scourging is in order. God allows pestilence, war, or some other plague to come, that we may humble ourselves before Him, fear [respect] Him, hold to Him, and call upon Him. When God has accomplished these purposes through the scourge, then the good angels come again to perform their office. They bid the devil stop the pestilence, war and famine. So the devil must serve us with the very thing with which he plans to injure us; for God is such a great master that he is even able to turn the wickedness of the devil into good.”*

In other words, God has morally sufficient reasons for permitting evil in the world.

God’s executioner

“The devil is often God’s unwitting tool. God sends no sickness into the world but through the devil. All sadness and sickness are of the devil not of God. for God permits the devil to harm us because he receives little regard from us. Whatever therefore, pertains to death is the handiwork of the devil; and conversly, whatever pertains to life is the blessed work of God… The devil must be our Lord Gods’ executioner.”**

An example of this from scripture:

Then he said, “Therefore hear the word of the Lord: I saw the Lord sitting on his throne, and all the host of heaven standing by, on his right hand and on his left. And the Lord said, ‘Who will persuade Ahab to go up, that he may fall at Ramoth Gilead? So one spoke in this manner, and another spoke in that manner. Then a [evil] spirit came forward and stood before the Lord, and said, ‘I will persuade him.’ then the Lord said to him, ‘in what way?’ So the spirit said, ‘I will go out and be a lying spirit in the mouth of all his prophets.’ And he said, you shall persuade him, and also prevail. Go out and do so.’ “Now therefore, look! The Lord has put a lying spirit in the mouth of all these prophets of yours, and the Lord has declared disaster against you.” 1Kings 22:19-23

Ahab the king had provoked God to anger and caused his people to sin.

From this it can be seen that God contracts the work of punishment out to the devil, who in turn, finds and recruits willing evil men to disguise himself behind and do his bidding. There is no shortage of murderers who will compete for the honour. There are always Stalin’s, Hitlers, Mau’s and Pol Pot’s waiting in line for an opportunity.

*, From: What Luther Says by Ewald M. Plass page 401

joe4060:

November 28th, 2012 at 4:29 am

nigelthebold

The eyewitness is the Creator himself who was obviously a witness to his own creation, and who then related it to Moses.

How are we going with the origin of DNA?

John Morales:

November 28th, 2012 at 4:34 am

joe4060, enough with the drivel — the important question is why does God have a penis?

(This is a biologist’s blog, you know)

jonmilne:

November 28th, 2012 at 4:35 am

My comment at #524 still says “Awaiting moderation”. Can someone please fix this?

No Light:

November 28th, 2012 at 5:00 am

Oi JOE4060,

Quit with the irrelevant Holy Babble and have the decency to answer the questions asked of you. An intelligent thinker should be easily able to do so, I mean, it’s not like you’re some muppet just parroting back what AIG or your pastor says.

So, once more:

Accurate descriptions of one-off historical events can only come from eyewitness accounts (like the Bible).

Which version of the Bible provides the most accurate description, and how?

Are any of the Old Testament Pseudepigrapha and New Testament Apocrypha essential to our understanding of events?

Who witnessed The Fall?

Why does Adam spend 40 days in the river Jordan?

Is merkabah still relevant to your understanding of the bible?

If Yahweh created Adam and Chava as the first humans, who did their sons (Abel, Cain and Seth) marry?

Thanks in advance!

Ing:Intellectual Terrorist “Starting Tonight, People will Whine” asked you:

And who was Cain protected from by his mark when he was banished?

John Morales:

November 28th, 2012 at 5:37 am

… and why does the almighty creator of the universe have this thing about foreskins, anyway?

Owlmirror:

November 28th, 2012 at 7:48 am

Since a misunderstanding of God’s nature seems to be the main problem here I will explain some things.

Because you magically know God’s nature?

The reason why bad things happen is not because God does not love us, or that he does not care, but because from Adam onwards we have largely wanted to live autonomously, without him, so he has let us experience this.

Sorry, wrong — assuming you think that the Bible was written by or inspired by God.

The verses that have been cited from the Bible are the bad things that God has deliberately done himself, or commanded be done.

The fact that we can’t understand why people die in wars and plagues only demonstrates our sinful, ignorant and blind condition, and that we cannot see that God always minimizes, or only allows the lesser evil to prevail, or the world would be in a far worse state than it is.

In the bible, God causes or commands** the greater evil.

So the devil can only ever be God’s slave

Which makes all evil God’s responsibility.

God will always cause the optimum conditions that ensure the salvation of as many people as possible.

Paul of Tarsus contradicts you in Romans 9.

He uses hardship and adversaries to get our attention and to humble our sinful, arrogant, rebellious, stuborn natures.

And who made man’s nature? God, according to the bible.

But we should also be aware that much of this goes against his good, kind and loving nature

What “good, kind and loving nature”? Why should we think that God has such a nature, when he deliberately does so much that is cruel and hateful?

In other words, God has morally sufficient reasons for permitting evil in the world.

Why are you making excuses for God?

The devil is often God’s unwitting tool. God sends no sickness into the world but through the devil.

Why should we care about what tool God uses? When the actions of an agent are judged, we don’t say that it was the fault of the tool they used; we put the responsibility on them.

From this it can be seen that God contracts the work of punishment out to the devil, who in turn, finds and recruits willing evil men to disguise himself behind and do his bidding. There is no shortage of murderers who will compete for the honour. There are always Stalin’s, Hitlers, Mau’s and Pol Pot’s waiting in line for an opportunity.

Or in other words, if you follow the chain of command back to its source, all evil is actually God’s fault.

======

The eyewitness is the Creator himself who was obviously a witness to his own creation, and who then related it to Moses.

And we know this because you say so, and you are the sole arbiter of what is true, right?

Nick Gotts (formerly KG):

November 28th, 2012 at 7:59 am

God allows pestilence, war, or some other plague to come, that we may humble ourselves before Him, fear [respect] Him, hold to Him, and call upon Him…

In other words, God has morally sufficient reasons for permitting evil in the world. – joe4060

That is truly vile: your imaginary friend, according to you, inflicts all kinds of tortures on people so they will grovel to him – and you call that “morally sufficient reasons for permitting evil”. Why do you worship a psychopathic sadist and megalomaniac, joe4060? Are you perhaps one yourself?

nigelTheBold:

November 28th, 2012 at 8:12 am

joe4060:

nigelthebold

The eyewitness is the Creator himself who was obviously a witness to his own creation, and who then related it to Moses.

How do you know? Were you there? Was there an eyewitness to this happening?

It’s been historically established that Moses didn’t write any book in the Bible. He certainly didn’t write of his own death, which he would’ve had to if he were the author of the decalogue. So your story here just doesn’t hold water.

I highly recommend the book, Jesus, Interrupted for an excellent overview of the history of the Bible, and how we know that history. It’s a well-written book by someone who studied the historical Bible, reporting on the current best understanding of the history of the Bible.

How are we going with the origin of DNA?

Pretty damned good, actually. How’s the explanation for the light from galaxies billions of light years away coming?

Also, and once again, abiogenesis is distinct from evolution. You can’t disprove evolution simply by claiming we are ignorant of the details of abiogenesis. Science doesn’t work that way. And since it seems obvious you aren’t interested in science, I’m not sure why it matters to you.

nigelTheBold:

November 28th, 2012 at 8:57 am

joe4060:

There’s a problem with the whole “God was an Eyewitness and had Moses write it down” proposition. I’d like to expand on it a little bit.

I mentioned that science, coupled with math and logic, is the only demonstrably effective epistemology. There’s a reason for that. Part of the reason is, every other epistemology has logical flaws.

I’ve already dissected your assertion that only eyewitness accounts provide accurate information about the past. I note you didn’t try to refute my counter-argument, so I believe it still stands. I’ve also argued that eyewitness accounts aren’t reliable. And since you haven’t refuted it, that counter-argument still stands. My claim that the Bible doesn’t even claim to be an eyewitness account has not been refuted. I’ll go one further: nowhere in the Bible does it claim Moses wrote any of the Bible.

So it isn’t the Bible that provides the basis for your claim that the Bible was written partially by Moses as narrated by God, as the Bible makes no such claim. That claim originates from people who came much later, and who were not eyewitnesses.

And so, using your own logic you cannot accept the Bible was partially written by Moses as narrated by God. To do so, you just have to believe people who made stuff up later.

I hinted at the epistemological problems with demanding eyewitnesses. That is, corroboration is required to have any kind of faith in the eyewitness testimony. And by faith I mean, tentative acceptance without evidence. People lie. People make mistakes. People misremember things.

People lie.

I’ve already asserted the Bible itself makes no claims about the authors of the Decalogue. You will find no reference about Moses writing those books. But for the sake of argument, let’s say he did.

Did you know the Book of Mormon was written by Joseph Smith as read from sacred gold plates with the help of an angel? And there were two eyewitnesses to that event, so it’s not just Joseph Smith making the claim.

Did you know the Qu’uran was written by Mohammed, as revealed by the angel Gabriel? True story!

So are the Book of Mormon and the Qu’uran also true, as they claim to be the word of God?

If not, how do you know which is the Real Word Of God? How do you know the others aren’t true?

Nick Gotts (formerly KG):

November 28th, 2012 at 9:03 am

How are we going with the origin of DNA? – joe4060

Read chapter two of Nick Lane’s Life Ascending. We have excellent evidence that DNA was not the first carrier of genetic information; it was preceded by RNA, which may itself not have been the first. For what is known an conjectured on the origins of RNA, read chapter 1. Abiogenesis is not a solved problem, but the implication that no progress has been made is simply a creationist lie. The implication that because we don’t know how abiogenesis occurred, this casts doubt on evolution, is another creationist lie.

theophontes (坏蛋):

November 28th, 2012 at 9:10 am

@ sloppy joe4060

How are we going with the origin of DNA?

The science or the babble? We discussed the issue of DNA and the babble upthread. DNA is explained in detail in the (non-canonical) writings of the religiously inspired. Right there around Genesis. You see Adam|Eve (a “janus” entity) is the double helix. When they are split by GAWD ™ they seek to reunite with that other half. This seeking to reunite works on DNA,RNA, protein level. It is the very process of life: What is DNA?

By now you have a problem. You have half of the story. You now have to find that second, missing part to have a full religious|scientific understanding. But your science, as you are so keen to publically prove, is shite. So you fail to understand what god is telling you, cause you simply don’t have the intellectual stamina to bring your half of the deal to the table. Don’t be sloppy and don’t let him down – learn science. An unhappy sky-god is not very pleasant.

/godly

theophontes (坏蛋):

November 28th, 2012 at 9:35 am

[Babble vs RNA]

God made Adam of clay | RNA Origins in Sheets of Clay

strange gods before me ॐ:

November 28th, 2012 at 9:40 am

theophontes,

It was working the other day, wasn’t it? I’m not sure if you’re telling me “it worked, and then I traveled elsewhere, where it didn’t work”, or “it worked, and then I did nothing different, and it stopped working”.

Anyway, try setting your clock to UTC, and make sure it’s accurate.

If that doesn’t help, download this, request password. (Iff you know how to use GPG, tell me your public key so we can streamline this. But I won’t recommend that you learn to use GPG just for this purpose.)

Tony ∞2012 recipient of the coronal mass erection∞:

November 28th, 2012 at 10:00 am

No Light:
Joe cannot answer any of those questions. I am sure he realizes it would be pointless to try since not only does he not have a copy of the original manuscripts, he couldn’t read them since they were not in English.

theophontes (坏蛋):

November 28th, 2012 at 10:05 am

@ SGBM

It works in Hong Kong (laptop) but not (surprise!) in China (PC).

Before the previous motherboard went FUBAR, it worked (for youtube too). That is, the first version you sent me worked perfectly in China. This one not.

PGP? (My question answers your question?)

I’ll check your new linky in Shenzhen tomorrow.

strange gods before me ॐ:

November 28th, 2012 at 10:15 am

(for youtube too).

It shouldn’t have. The bundle is supposed to not interact with Flash and other plugins that you already have installed in other browsers. So, unless you installed Flash into the bundle and then forgot about doing so, that was a bug.

PGP? (My question answers your question?)

Yes, GPG is a PGP implementation. Your not providing a public key answers my question.

theophontes (坏蛋):

November 28th, 2012 at 10:15 am

@ Tony

Joe cannot answer any of those questions.

To my mind, a huge failure of Xtianity is that you need do next to nothing to join. The religious wisdom of old was transfered to initiates over many years, with great efforts on their part.

Now we can just yell:”Jeebus is LAWD ™ !” and GAWD ™ does the rest. Bible study? A glorified book-club (with only one book at that). It is little wonder his ilk are so incredibly ignorant.
.
.
.

sigh

The quality of trolls is dropping precipitously.

strange gods before me ॐ:

November 28th, 2012 at 10:19 am

The bundle is supposed to not interact with Flash and other plugins that you already have installed in other browsers

because Flash, etc, can be manipulated into disclosing a user’s real IP. This is presumably not a concern of yours, if you are only interested in getting out. So it should be safe enough for you to install Flash into the bundle.

theophontes (坏蛋):

November 28th, 2012 at 10:22 am

@ SGBM

Best I fiddle a little first and get back to you. (I hear that Adobe were going to dump a lot of their support for alternative operating systems. I don’t mind dumping them in turn. I can always find a workaround … from your VLC suggestion to waiting ’til I return to cybercivilisation.)

theophontes (坏蛋):

November 28th, 2012 at 10:31 am

@ Tony

PS: An unfortunate effect of what I noted above: Crass literalism.

(I cannot imagine any contemporaries of the original writers being so religiously shoddy as to fall into such an obvious chthonic hole.)

strange gods before me ॐ:

November 28th, 2012 at 10:44 am

The religious wisdom of old was transfered to initiates over many years, with great efforts on their part.

Uh, sometimes?

Most ancient religions were not mystery cults, and someone who was not a member of any mystery cult nevertheless had religion.

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 28th, 2012 at 10:49 am

Citation to prove I know what I’m talking about

13 Cain said to the Lord, “My punishment is more than I can bear. 14 Today you are driving me from the land, and I will be hidden from your presence; I will be a restless wanderer on the earth, and whoever finds me will kill me.”

15 But the Lord said to him, “Not so[e]; anyone who kills Cain will suffer vengeance seven times over.” Then the Lord put a mark on Cain so that no one who found him would kill him. 16 So Cain went out from the Lord’s presence and lived in the land of Nod,[f] east of Eden.

17 Cain made love to his wife, and she became pregnant and gave birth to Enoch. Cain was then building a city, and he named it after his son Enoch. 18 To Enoch was born Irad, and Irad was the father of Mehujael, and Mehujael was the father of Methushael, and Methushael was the father of Lamech.

19 Lamech married two women, one named Adah and the other Zillah. 20 Adah gave birth to Jabal; he was the father of those who live in tents and raise livestock. 21 His brother’s name was Jubal; he was the father of all who play stringed instruments and pipes. 22 Zillah also had a son, Tubal-Cain, who forged all kinds of tools out of[g] bronze and iron. Tubal-Cain’s sister was Naamah.

23 Lamech said to his wives,

“Adah and Zillah, listen to me;
wives of Lamech, hear my words.
I have killed a man for wounding me,
a young man for injuring me.
24 If Cain is avenged seven times,
then Lamech seventy-seven times.”

We see that clealry

a) The Mark of Cain is a sigil of protection warning people that God has already punished this person and further harm to them will be greatly punished
b) There were people outside of his family that Cain had reason to fear being killed by
c) Cain either married his sister who was banished along with him (God is a dick) or he married someone in the land of Nod (a Noddling if you will).

B directly shows that the story as commonly interpreted by Christians is just wrong and not the original intent. Clearly either Adam and Eve were never intended to be seen as the literal first people on earth and propagators of all mankind, but the founding figures of the culture who came up with the myth OR the story has blatant contradictions and plot holes removing the possibility of both direct witnessing and infallibility. Either way the story is wrong on a profound fundamental level.

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 28th, 2012 at 10:50 am

To my mind, a huge failure of Xtianity is that you need do next to nothing to join. The religious wisdom of old was transfered to initiates over many years, with great efforts on their part.

Yes it’s called commitment bias. It’s done by cults to trap people in there due to how much they’ve already spent for the church.

Or are you actually arguing that Mormonism and Scientology is better and more responsible than Xtianity?

Caine, Fleur du mal:

November 28th, 2012 at 10:52 am

Since a misunderstanding of God’s nature seems to be the main problem

Oy, the density. The only one with a problem is you. There is no misunderstanding of god’s nature. Either you believe the bible is god’s word or you don’t. You claim to believe the bible is god’s word. As that is the case, stop with the tortured apologetics and face up to the word – your god is a sadistic, murdering thug and you think that’s just dandy, which makes you someone who has all the moral fiber of a wet tissue.

Have you never pondered or asked yourself why there are reams of twisted, tortured apologetics for the bible and xianity all over the place? It’s because most thinking people who have actually read the bible are utterly appalled by the acts and commands of god (all the contradictions and lies don’t help either) and quickly scramble to find some way to justify all the horrifying crap.

Don’t resort to the standard “new testament! Jesus!” crap, either. Jesus wasn’t any better and held to the thuggery of the OT.

You don’t get things both ways, Joe, let alone every direction. You take the bible as god’s word, you take the bible literally, you believe it is full of eyewitness accounts. You don’t get to claim it’s a big misunderstanding when someone else takes the murder book at its word. If there is one thing that is crystal clear in that muddy book of murder, it’s the nature of your so-called god.

A. R:

November 28th, 2012 at 11:03 am

We haz a troll?

theophontes: Chilly here today.

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 28th, 2012 at 11:06 am

The religious “wisdom” of old was transfered to initiates over many years, with great efforts on their part.

FTFY

Just because something is difficult to do doesn’t mean it’s worth it. FWIW I find a lot of the alleged old “wisdoms” of said cults either blatantly laughably false or trite and things you could easily just explain to someone over coffee

Owlmirror:

November 28th, 2012 at 1:07 pm

WWJD?

(What Will Joe4060 Do?)

- Flee

- Moar apologetics

- Run away

- Settle down and discuss epistemology

- Decide he’s had enough and refuse to return

- Cite more bible verses

- Give up on us as damned heathen

- Change the subject

- Find something else to do

- Post more ludicrous non-sequiturs

- Go on a long trip with no internet access

(any redundancy in the list above is entirely deliberate)

nigelTheBold:

November 28th, 2012 at 1:34 pm

joe4060:

Since a misunderstanding of God’s nature seems to be the main problem here I will explain some things.

Well, I’d say the real problem is a misunderstanding of epistemology and science.

I would suggest, though, that we stick to a single topic, rather than jump around from science (including the epistemology of science, the scientific method, and the knowledge we’ve gained by the application of the scientific method) to theology to history. As it is, it seems you’re all over the place, which makes for a difficult discussion.

Since the debate started off with you declaring that evolution is wrong, and presenting a list of arguments against evolution, why don’t we stick with that? As it stands, I have answered most of your arguments against evolution. I suggest you pick one argument against evolution, and we can discuss that until we are satisfied we’ve covered it sufficiently. We can discuss epistemology and science as appropriate.

Does that sound OK to you?

joe4060:

November 28th, 2012 at 2:36 pm

nigelthebold

Non of your back and forth questions mean anything until the original question gets answered.

You cannot have evolution until there is something for evolution to work with.

How did everything come to exist in the first place?

There are only two options:

It either created itself from nothing, or it was created from nothing.

If your claim is true that it created itself from nothing then where did all the required information come from? Information is non-physical. It gets carried around in physical mediums but in itself it is non-physical.

What caused atoms, which have no intelligence, to begin to arrange themselves into complicated forms that could hold life?
Surely they would have required a higher intelligence to direct them. What was the source of this intelligence?

I think it takes a lot more faith to be an athiest than it does to believe in a personal Creator.

CJO:

November 28th, 2012 at 2:43 pm

From this it can be seen that God contracts the work of punishment out to the devil, who in turn, finds and recruits willing evil men to disguise himself behind and do his bidding.

The problem with this is that the Bible is not a continuous, coherent witness to any particular theodicy. Exactly as we would expect if the biblical narratives originated at different times in different places and were written with divergent agendas.

Take, for instance, the parallel narratives found in 2 Samuel 24 and 1 Chronicles 21, about David taking a census of the Israelites and God’s punishment for same.

2 Sam 24:1 reads

Again the anger of the LORD was kindled against Israel, and he incited David against them, saying, “Go, number Israel and Judah.”

Odd, that. But 1 Chron 21 lets God off the hook:

Then Satan stood against Israel and incited David to number Israel.
(my emphasis)

This is an entirely typical revision of the Deuteronomistic History (1 Sam through 2 Kings) by the so-called Chronicler, and it betrays clear discomfort, in a later, more enlightened age, with the notion that God himself would directly entice behavior for which he would later punish his servant, a plot device the author(s) of the Deuteronomistic History had no trouble at all with. It also shows development of the figure of satan itself, which is an impersonal adversary and servant of God in the Deuteronomistic History (ha’satan rendered as “an evil spirit” in your quotation) but treated as the proper name of an independent actor in Chronicles.

The upshot of this is that the Bible is a reliable witness to nothing but the theological and socio-historical agendas of its many and diverse authors.

Esteleth has eaten ALL the gingerbread! Suck it!:

November 28th, 2012 at 2:48 pm

But the “something” (in this case, DNA) did not come from nothing.

DNA, in all likelihood, is a modification of RNA. The uracil in RNA is converted to thymine by the addition of the 5-methyl, ribose is deoxygenated to form deoxyribose, and the bases pair up to made dsDNA. And RNA itself has components that all have plausible origins. It all leads back to the spewing forth of matter in the Big Bang. And pre-BB, it isn’t that there was nothing, it is that everything was incredibly densely packed.

nigelTheBold:

November 28th, 2012 at 2:48 pm

joe4060:

Non of your back and forth questions mean anything until the original question gets answered.

You cannot have evolution until there is something for evolution to work with.

How did everything come to exist in the first place?

You miss the point. The question about the validity of evolution is independent of the question of how life arose. All the evidence points towards evolution being a true thing. Denying that is denying reality.

The question of abiogenesis is definitely and important question. We have ideas on how it might have occurred. We even have some decent models that demonstrate the various stages from some substrates (like clay) to minimal self-replication to RNA to DNA.

What you are doing is insisting we know everything about everything. The great thing about science is, you can know some things without knowing others. We can know that gravity works without knowing how it is tied to quantum mechanics. We can know quantum mechanics works without knowing whether string theory is the correct interpretation of quantum mechanics. We can be ignorant of some things while knowing others.

Now, if you want to be able to claim knowledge, you could make something up, like God kickstarted the whole process, and shepherds it along. The one thing you cannot do and remain intellectually honest is deny the evidence, and deny what the evidence leads to.

And right now, the evidence is for a 14 billion year old universe, and life arose on Earth 3.5 billion years ago, and life has evolved since then into what we see today. That’s just where the evidence leads.

The question of how that life started 3.5 billion years ago is up for debate. The question of the processes that have shaped life since then aren’t nearly as much up for debate. (Some details are still debated, but those are just details.)

Esteleth has eaten ALL the gingerbread! Suck it!:

November 28th, 2012 at 2:52 pm

Oh, and:

What caused atoms, which have no intelligence, to begin to arrange themselves into complicated forms that could hold life?

Atoms hit each other randomly. The probability of this is controlled by the density of the atoms, how much energy they have, and also factors like charge. Things that are oppositely charged will hit each other more readily. Every time to particles hit each other, some percentage of the time (mostly related to thermodynamics) they stick to ach other. These resulting clumps then go on to hit other particles, some of which stick.

No intelligence required. Just physics.

Esteleth has eaten ALL the gingerbread! Suck it!:

November 28th, 2012 at 2:54 pm

Joe, what you’re forgetting – or ignoring – is that most atheists were at one time believers. And many atheists say that one of the last straws for them WRT religion was studying religion intensely.

strange gods before me ॐ:

November 28th, 2012 at 3:06 pm

joe,

Here’s a thing you might find interesting, if you want to try it: ask yourself and us why do we not consider “information is non-physical” to be an argument suggestive of a deity’s existence?

Perhaps not to your taste. I just figured it might be stimulating.

nigelTheBold:

November 28th, 2012 at 3:24 pm

joe4060:

I think it takes a lot more faith to be an athiest than it does to believe in a personal Creator.

Hold on now, joe4060 (may I refer to you as Joe?). You’re conflating atheism and science here. You can follow science where it leads, and still believe in a Creator. Kenneth Miller is an excellent example of someone who both accepts where the science leads, and firmly believes in the Christian creator.

Be careful not to confuse science (including the results of science, like the theory of evolution) with atheism.

You don’t have to choose between your God and the results of science.

Nick Gotts (formerly KG):

November 28th, 2012 at 3:55 pm

joe4060,

Non of your back and forth questions mean anything until the original question gets answered.

If none of the back and forth questions mean anything, why do you argue about them? Why, on Greta Christina’s thread, where you rudely hijacked a thread, did you cut and paste a range of spurious-to-stupid “arguments” about the fossil record, Y-chromosomes etc., from the shameless liars at creation.com? The fact is, of course, that you have no answer to nigelTheBold’s evisceration of your claims, because you are profoundly ignorant: all you are capable of is copying and pasting, then changing the subject when you find you’re dealing with someone who knows what they are talking about.

You cannot have evolution until there is something for evolution to work with.

How did everything come to exist in the first place?

So now you’ve switched from evolution, not to abiogenesis, but to cosmogenesis. Changing the subject again.

There are only two options:

It either created itself from nothing, or it was created from nothing.

No, in fact neither of these is possible. For something to be “created”, or to “create itself”, there must have been a time when it did not exist: so to talk of everything being created, or creating itself, is self-contradictory. There may have been an “earliest time”, but if so, something already existed at that time.

If your claim is true that it created itself from nothing then where did all the required information come from? Information is non-physical. It gets carried around in physical mediums but in itself it is non-physical.

You’ve no idea what you’re talking about at all, have you? Wherever there is any sort of physical existence, there is information; you don’t have to add it.

What caused atoms, which have no intelligence, to begin to arrange themselves into complicated forms that could hold life?

A long series of physical processes, many but not all of which are now understood.

Surely they would have required a higher intelligence to direct them.

Why? We can observe the emergence of order in many natural processes that do not involve life or intelligence, and that we can observe happening: the action of the tides can, in places such as Chesil Beach, sorts stones according to size. Gravity works in similar ways to gather asteroids in particular orbits, and remove them from others, or to produce the complexities of the rings of Saturn. Flows of liquid methane on titan produce patterns of twisting, joining, branching channels startlingly like those of rivers of water on earth – because the processes concerned are similar. On the seabed, flows of hot, mineral-rich water from below the surface produce weird rococo structures, including the alkaline hydrothermal vents which you can read about in the linked paper (but I bet you won’t), and which may well have been the kind of environment in which life emerged. These vents form honeycombs of compartments lined with catalytic minerals, through which mixtures of reactive chemicals flow, under the complex interacting influences of hydrological, chemical and thermal gradients. Kind of like a giant chemical laboratory in which an endless parade of experiments takes place without any need for a chemist.

What was the source of this intelligence?

You have given no reason to suppose one was needed. But if one was, then in order to have explained anything at all we would have to know how this “personal creator” comes to exist, and how it is able to create everything else.

I think it takes a lot more faith to be an athiest than it does to believe in a personal Creator.

No, you don’t: that’s just what you’ve been told to say. You haven’t come out with a single thought that is your own. Why not try thinking for yourself one day? You might enjoy it.

nigelTheBold:

November 28th, 2012 at 4:44 pm

Joe:

What’s the source of God’s intelligence?

I’m just curious. Drunk, and curious.

John Morales:

November 28th, 2012 at 4:49 pm

nigelTheBold, duh.

It either created itself from nothing, or it was created from nothing.

Tony ∞2012 recipient of the coronal mass erection∞:

November 28th, 2012 at 8:49 pm

Nigel:
You’re drunk battling a creationist?
Damn, you are good.

Tony ∞2012 recipient of the coronal mass erection∞:

November 28th, 2012 at 8:53 pm

Hold on…”misunderstanding of gods nature”? I thought we lowly humans could never understand god because he is infinite and perfect. When did he stop being inscrutable?

joe4060:

November 28th, 2012 at 9:02 pm

nigelthebold

Let me put it another way.

Is the information that is required to build a house, in the bricks of the house, or is it in the mind of the builder?

For every house is built by someone, but he who builds all things is God. Hebrews 3:4

Does the clay make itself into a pot?

Do the letters and punctuation write themselves into a book?

Tony ∞2012 recipient of the coronal mass erection∞:

November 28th, 2012 at 9:21 pm

Whats the deal with the raging hardon for the source of information? Howzabout I DONT FUCKING KNOW? The arrogance displayed by believers is astounding. They strawman atheists by saying ‘you reject god, therefore you think the universe was formed by X’. That is simply not true for all atheists. Some do. Some don’t. Myself, I don’t know how everything came to be and I don’t really mind not knowing.
Believers, OTOH, think they absolutely, beyond a shadow of a doubt, know that god did it. Without a shred of evidence, and with the universe providing no proof of their god of evil, Yahweh, they have the answers. Yet somehow atheists are arrogant when we say I DO NOT BELIEVE YOUR GOD CLAIMS OR ANYONE ELSE’s. Just like we do not believe the claims of Mormons, Scientologists, or the ancient Greeks.

strange gods before me ॐ:

November 28th, 2012 at 9:29 pm

I suppose this is going to be a repeat of the no contest thread.

joe4060, if I may make my suggestion again: it might be more interesting, for both us and you, if you’d ask yourself and us why do we not consider “is the information that is required to build a house in the bricks of the house, or is it in the mind of the builder” to be an argument suggestive of a deity’s existence.

What I mean is, it might be worthwhile for you to brainstorm about the following — if you’re going to make argument X, consider that we’ve probably heard X before and for some reason it wasn’t persuasive, so, imagine first what ideas a person might already have which could make argument X unpersuasive. And/or just ask us why we aren’t persuaded.

Surely you’ve debated previously with people who accept the fact of evolution. Perhaps, if you did not find such debates very fruitful, my suggestion might lead to more intriguing outcomes?

John Morales:

November 28th, 2012 at 9:30 pm

joe4060:

For every house is built by someone, but he who builds all things is God.

This is both nonsensical and self-refuting on multiple levels, since it (1) claims God is not a member of all things (implying God does not exist) and (2) further compares everything to a dwelling (a clear category error) and (3) it claims God built itself (but until God existed God could not build anything).

–

Also, I see you are strenuously avoiding the issue of God’s penis — inquiring minds want to know whether it is circumcised.

John Morales:

November 28th, 2012 at 9:43 pm

joe4060:

Do the letters and punctuation write themselves into a book?

O ye of little faith: is it not written that
In the beginning was the Word, and the Word was with God, and the Word was God?

Esteleth has eaten ALL the gingerbread! Suck it!:

November 28th, 2012 at 9:51 pm

Ah, but John, that is metaphor.

Because the Bible is literal, except when it is clearly metaphor.

Tony ∞2012 recipient of the coronal mass erection∞:

November 28th, 2012 at 10:04 pm

Esteleth:
Was the Flood literally God going full on genocidal baby killer or was it a metaphor? And where, oh where, is a pastor to tell me how I should interpret a flood that killed a lot of precious fetuses?

Esteleth has eaten ALL the gingerbread! Suck it!:

November 28th, 2012 at 10:10 pm

Remember about generational sin, Tony. Those fetuses parents were bad people, so they were going to be bad people themselves.

theophontes (坏蛋):

November 28th, 2012 at 11:00 pm

@ SGBM

Uh, sometimes?

Oh, the liabilities of shooting from the hip!

As I understand it, there was less crass literalism than one would find in today’s goddists (particularly those of joe’s stripe). Not everyone, of course would or could become initiated into the mysteries. As much as there might have been attempts to imbue gods with an appropriate awe, they often carried across as little more than characters in a soap opera. As for the initiates, the meanings could be peeled back gradually to reveal different layers of meaning.

As to the real “wisdom” of these, Ing notes:

either blatantly laughably false or trite and things you could easily just explain to someone over coffee

The highest level that I could envisage (I am no initiate) is that the ultimate meaning of (for example) the corn or year gods, is nothing more than underscoring the cycle of planting and harvesting. ‘Why all the religious rigmarole?‘, one asks. Perhaps this: the whole agricultural process is both exceptionally dull and exceptionally important. One may embroider on it, seek deeper meanings even, but it all comes back – in the end – to planting and harvesting.

@ Ing

In terms of rapid expansion, the huge advantage of xtianity over, say, Greek Paganism, was the relatively low entrance cost. One did not need all the trappings (“the church is not a building”), from temples to hecatombs. It was a religion suited to the poor, rather than a wealthy elite. Later the xtian church itself (as institution) went for quantity rather than quality.

eg:In Byzantine times it was a scramble into the lands of the Rus to claim as many souls as possible (Cyrillic was invented specifically to give them a written language with which to mass produce priests). The consequence was that the new “converts” came along riddled with their own folk superstitions and traditions.

Or are you actually arguing that Mormonism and Scientology is better and more responsible than Xtianity?

I had not specifically considered this. What I want to address is the declining quality of godbot. In the examples you give, I would think that – by investing so much energy in actually trying to understand their own tenets – a mormon or scientologist might well make a better and more responsible consequential godbot.

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 28th, 2012 at 11:05 pm

For Fuck sake you unoriginal, dishonest conflating nitwit

http://en.wikipedia.org/wiki/Information

As an influence which leads to a transformation

Information is any type of pattern that influences the formation or transformation of other patterns. In this sense, there is no need for a conscious mind to perceive, much less appreciate, the pattern. Consider, for example, DNA. The sequence of nucleotides is a pattern that influences the formation and development of an organism without any need for a conscious mind.

Systems theory at times seems to refer to information in this sense, assuming information does not necessarily involve any conscious mind, and patterns circulating (due to feedback) in the system can be called information. In other words, it can be said that information in this sense is something potentially perceived as representation, though not created or presented for that purpose. For example, Gregory Bateson defines “information” as a “difference that makes a difference”.

If, however, the premise of “influence” implies that information has been perceived by a conscious mind and also interpreted by it, the specific context associated with this interpretation may cause the transformation of the information into knowledge. Complex definitions of both “information” and “knowledge” make such semantic and logical analysis difficult, but the condition of “transformation” is an important point in the study of information as it relates to knowledge, especially in the business discipline of knowledge management. In this practice, tools and processes are used to assist a knowledge worker in performing research and making decisions, including steps such as:

reviewing information in order to effectively derive value and meaning
referencing metadata if any is available
establishing a relevant context, often selecting from many possible contexts
deriving new knowledge from the information
making decisions or recommendations from the resulting knowledge.

Stewart (2001) argues that the transformation of information into knowledge is a critical one, lying at the core of value creation and competitive advantage for the modern enterprise.

The Danish Dictionary of Information Terms[4] argues that information only provides an answer to a posed question. Whether the answer provides knowledge depends on the informed person. So a generalized definition of the concept should be: “Information” = An answer to a specific question”.

When Marshall McLuhan speaks of media and their effects on human cultures, he refers to the structure of artifacts that in turn shape our behaviors and mindsets. Also, pheromones are often said to be “information” in this sense.

In physics, physical information refers generally to the information that is contained in a physical system. Its usage in quantum mechanics (i.e. quantum information) is important, for example in the concept of quantum entanglement to describe effectively direct or causal relationships between apparently distinct or spatially separated particles.

Information itself may be loosely defined as “that which can distinguish one thing from another”

Now shuddup

Tony ∞2012 recipient of the coronal mass erection∞:

November 28th, 2012 at 11:09 pm

Esteleth:
Ooooooh. Ok.
So then there is nothing wrong with abortion, right?

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 28th, 2012 at 11:11 pm

Perhaps this: the whole agricultural process is both exceptionally dull and exceptionally important.

My family comes from a long line of agrarians. The jokes I made about humorous hay seed grandfather aphorisms were entirely factual. I have literally sat through three hour intense discussions on corn qualities. I assure you that it is not dull to people who are of passionate on the subject. You are projecting a value that is not shared.

And of more importance the crop cycle can be just as easily understood and grasped without a secret handshake

In terms of rapid expansion, the huge advantage of xtianity over, say, Greek Paganism, was the relatively low entrance cost. One did not need all the trappings (“the church is not a building”), from temples to hecatombs. It was a religion suited to the poor, rather than a wealthy elite. Later the xtian church itself (as institution) went for quantity rather than quality.

eg:In Byzantine times it was a scramble into the lands of the Rus to claim as many souls as possible (Cyrillic was invented specifically to give them a written language with which to mass produce priests). The consequence was that the new “converts” came along riddled with their own folk superstitions and traditions.

You’ve basically just described the difference between r/K selection strategies, another deep wisdom from religion?

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 28th, 2012 at 11:14 pm

Is the information that is required to build a house, in the bricks of the house, or is it in the mind of the builder?

For every house is built by someone, but he who builds all things is God. Hebrews 3:4

Does the clay make itself into a pot?

Do the letters and punctuation write themselves into a book?

Ignoring your appeal to authority, you are begging the question. I’ll return it back to you. DOES everything need a builder? I can see houses being built and thus from inference know they are constructed things. I can learn via pattern recognition the hall marks of human design and craft enough to note when a mark on a rock looks to be done by flint tool rather than natural erosion. I do not see anyone at any point of time making a tree or boulder or dirt.

John Morales:

November 28th, 2012 at 11:15 pm

theophontes, not only have the Jews been at this bizzo longer than the Christians, but they are more interesting.

(Pardes clarifies the categorical distinctions between the exoteric and the esoteric, the which is nearly as far beyond clueless godbots (such as joe4060) as it is amoebae)

Rev. BigDumbChimp:

November 28th, 2012 at 11:20 pm

The watchmaker argument really really gets boring the 700th time you’ve had it thrown at you.

Fuck Paley.

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 28th, 2012 at 11:28 pm

@Rev

and really do we need anything but the stock response of “how can you tell what’s a watch in a world made of clockwork?”

theophontes (坏蛋):

November 28th, 2012 at 11:30 pm

I failed to mention the aspirational quality of the Pagan myths. Obviously these where of great consequence in helping along the whole drive to excellence that we spoke of several iterations of thread ago. We also noted however that these were not to be taken literally, pace Julian. We noted also the role of myth even in modern times. The whole point is that in none of these are the myths taken as literal truths. Unlike goddist myths, they do not rely on lying to be efficacious.

.

mini-rant ™

OK, I’m actually more than a little pissed off at the quality of godbots (PZ, how are we supposed to sharpen our teeth on these?). What happened to the old fashioned type? Where are the William James’s of this world? Is xtianity failing to produce any intelligent arguments anymore? The rot has been setting in for a while now. Of all the things that religion poisons, what grates me the most right now is that it poisons ideas and debate.

I read recently an (old) article by W.R. Inge about the influence of Greek thought on the xtian worldview (particularly Plato). He makes his arguments well enough. All a good basis for further discussion, until this:

The choice before us is between a ‘post-rational’ traditionalism, fundamentally sceptical, pragmatistic, and intellectually dishonest, and a trust in reason which rests really on faith in the divine Logos, the self-revealing soul of the universe. It is the belief of the present writer that the unflinching eye and the open mind will bring us again to the feet of Christ, to whom Greece, with her long tradition of free and fearless inquiry, became a speedy and willing captive, bringing her manifold treasures to Him, in the well-grounded confidence that He was not come to destroy but to fulfil.

/rant

John Morales:

November 28th, 2012 at 11:52 pm

The coming of the Lord is in every true Christian’s mouth.

<piety>

Tony ∞2012 recipient of the coronal mass erection∞:

November 29th, 2012 at 12:21 am

Joe:
An early holidays present– http://www.stonemakerargument.com/1.html

Tony ∞2012 recipient of the coronal mass erection∞:

November 29th, 2012 at 12:23 am

Oh I just went in the gutter with your comment JOHN. I feel dirty. Heh. Heh.

Tony ∞2012 recipient of the coronal mass erection∞:

November 29th, 2012 at 12:29 am

theophontes:
Have you folks primarily dealt with xtian apologetics here (@ Pharyngula)? Or have there been any other religious apologists for you all to battle against? A Scientologist sounds like a fun believer to debate.

theophontes (坏蛋):

November 29th, 2012 at 12:30 am

@ joe4060 vs SGBM

“information is non-physical”

Shall I kick off with a suggestion that we first examine the difference between Noise and Information.

Quick example: A person on the bus calls a friend to say that they will meet up at 7pm. To me this is noise. theaphontes calls to say I can collect the washing from the laundrette. This is information. (Immediately we are dragged into a subjective view of information.)

Joe, is the particular layering of the clays mentioned by nigelTheBold information or noise? Where does YHWH come into this?

Does the clay make itself into a pot?

No, but clay (it appears) has the potential to create the component strands of RNA. Over time we have DNA and over more time a potter to make a clay pot. The clay did it!!!

(re: the house… concrete or clay bricks?)

@ Ing

You are projecting a value that is not shared.

A lot of what would make it exciting for early agrarians was the delightful mysteries, the pageantry, traditions and the like. I do not think we are really at odds here. (I happily confess to being a city person though. Likely I would be bored by (to me superficial) corn qualities. But certainly not by corn myths.)

And of more importance the crop cycle can be just as easily understood and grasped without a secret handshake

Ing, you are such a party pooper! (What really gives religion a zing is when blood gets shed. This is not lost on contemporary goddists either.)

another deep wisdom from religion?

Memetic ecology rather. (The xtian approach seems to have worked in the numbers game.)

@ John Morales

Pardes

Your intentions were good John. But now I feel even worse. (Where, in Awlmarty Jeebus’s name, are we gonna find one of those?)

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 29th, 2012 at 12:39 am

Memetic ecology rather. (The xtian approach seems to have worked in the numbers game.)

Which ironically means they’re prone to greater mutation rate due to shorter generation time :-p

theophontes (坏蛋):

November 29th, 2012 at 12:52 am

@ Tony

I feel dirty.

Its the clay.

There is a beautiful story that Lilith was made of slime and dregs (as opposed to Adam’s clay). She insisted that they try different sex positions, rather than Adam always on top, because the stuff she was made of was equivalent to the stuff Adam was made of. (GAWD’s solution: Eve)

@ Tony

xtian apologetics

Sadly most godbots coming here are of that ilk. We get an occasional islamic bot (eg: Hamza Tzortzis), but most of the food is Ham, Ham and more Ham. (Even the islamic arguments taste more and more of Ham. The only advantage of Hamza, is that he has nice tone.)

Tony ∞2012 recipient of the coronal mass erection∞:

November 29th, 2012 at 1:17 am

Beep
Beep
Beep
Horde alert!
If anyone wants another chewtoy, look no further than the Christianity is not a religion thread. It goes by _devotions_.

John Morales:

November 29th, 2012 at 1:21 am

Actually, I kinda hope a Scientologist apologist comes here — I have spent countless hours* disputing with a decades-long committed Scientologist and have had occasion to peruse their tech manuals (and I don’t mean in the internet, I mean actual physical source material).

(I wonder how their moon-base is going? ;) )

–

* In person, including all-nighters.

(To hir credit, neither of us got worn down by that marathon)

Tony ∞2012 recipient of the coronal mass erection∞:

November 29th, 2012 at 1:24 am

John:
Moon base?
Egads!

John Morales:

November 29th, 2012 at 1:32 am

Tony, you have to understand that Clears are free of all human weakness (including self-imposed physical and intellectual limitations) and OTs (Operating Thetans) are effectively superhuman — even now LRH is exploring reality, knowing his legacy is secure.

(The MEST (Matter Energy Space Time) continuum is their plaything, though reality is the consensus of us unconscious Thetans)

theophontes (坏蛋):

November 29th, 2012 at 1:56 am

@ Ing

Which ironically means they’re prone to greater mutation rate due to shorter generation time.

Heh. Consider also that the new beliefs are a chimera, composed of whatever woo was doing the rounds at the time grafted onto a jerry-rigged xtian stock. The mutations got amplified.

I wonder if Joe4060 has any real grasp of where the modern mutations of his religion come from.

@ John Morales

MEST

Dutch for pig/cow pooh.

theophontes (坏蛋):

November 29th, 2012 at 2:02 am

{theophontes walks nonchalantly across the stage, mumbles to no-one in particular}

Would our eBil oBerlawd ™ consider allowing guest godbot/trolls onto Thunderdome thread? John M’s bud, me’be?

{exeunt}

theophontes (坏蛋):

November 29th, 2012 at 2:50 am

[Levels of meaning]

Rick Warren appeared on CNN recently. Apparently his book “Teh Porpoise Drivel Laugh” is 10 years old. Callooh Callay, let us declare a national holiday.

Rick (I must needs paraphrase):

There are 3 types of laws in the babble:
1. Civil. To which xtians are not bound. One is not obliged to kill one’s teenager for backchat.
2. Ceremonial. To which xtians are not bound. One does not have to slaughter unblemished goats.
3. Moral. To which xtians are bound. It is important for xtians to hate teh gayz. God is an insufferable bigot and we (at least males) are made in His image. Therefore.

Actions are sins. (fapping about your neighbour’s wife is fine, as long as it doesn’t come out of your head.) (not what jeebus said, but WTF, we’re selling books aren’t we?)

Tone trolling: Be NICE to eBeryone’s positions. Especially bigots.

One example is good to extrapolate to an entire society.

I just had to get that out there, to spread his religiously inspired wisdom.

Tony ∞2012 recipient of the coronal mass erection∞:

November 29th, 2012 at 3:55 am

Thanks to you spreading wisdom, I will be counting Jesus Christ’s instead of sheep to fall asleep…

Esteleth has eaten ALL the gingerbread! Suck it!:

November 29th, 2012 at 8:58 am

Tony:

>Ooooooh. Ok.
So then there is nothing wrong with abortion, right?

If a man chooses it, yes.

See, the absolute right to a woman’s output lies with the man who owns her.

If some uppity girl tries to take control, then she’s unnatural. But if some manly d00d doesn’t want her to have a baby, well then that’s his prerogative.

vaiyt:

November 29th, 2012 at 9:34 am

Gravity is gravity; it is dead.

Typical religiot, introducing an argument just to dismiss it when it gets turned against them. If you think gravity is dead, go throw yourself off a building.

Gravity and evolution both explains things that are. Matter attracts matter, that’s a fact. Life changes over time and passes traits to its descendancy, that’s a fact. Just like it’s not necessary to know where gravity come from for the Theory of Gravity to work, we don’t need to know where life came from for the ToE to work.

Where did LIFE come from?

We’re still trying to find out. Unlike religiots, people who actually want to learn about reality aren’t afraid of what they don’t know. 100 years ago we didn’t know how atoms worked, and now we can split them for energy.

Life exists. The Theory of Evolution explains how life works, and does its job with accuracy. On the other hand, we never found out anything new about life by reading sacred texts.

nigelTheBold:

November 29th, 2012 at 10:29 am

joe4060:

Let me put it another way.

Is the information that is required to build a house, in the bricks of the house, or is it in the mind of the builder?

The mind of the builder is physical. The neurons and their dendrites are physical. The information is in the specific patterns of electrochemical potentials arrayed through the brain.

No matter which way you put it, information is ultimately relationships between physical things. Even in the abstraction in the builder’s head, the abstraction represents the bricks and mortar and the way to fit them all together to build a house rather than a pile of rubble. Without the physical bricks and mortar, there would be no plan. In fact, a plan would be impossible.

Abstractions such as logic are about physical things (and the processes, properties, and relationships of physical things). The axiom of identity, the most fundamental of all logical axioms, is based on the physical properties of the universe. If we lived in a universe in which one thing transmuted into another (or multiple others), and two objects could occupy the same space, and so on, there would be no axiom of identity. Even our most fundamental abstract concepts are built on the relationships between physical things. (Mathematics and logic are basically information about information. That’s kinda cool.)

Just as the builder’s plan was about relationships between physical things, even fantasy requires relationships between physical things — imaginary physical things, certainly. But the fact these physical things don’t actually exist doesn’t change the fact that all fiction describes relationships between physical things. Otherwise, it wouldn’t make sense, and wouldn’t be information.

And you’re dodging the points raised against you. You still treat DNA as if it were a written language, an abstract communication medium. Did you read the essay I linked for you? The one that stated exactly what I stated over at Greta’s? The one that stated that DNA is not a code? (At least, not a code like written language is a code.)

If you continue to misattribute properties to DNA that it simply doesn’t have, you will be confused. You will misunderstand life, its origins, and the processes by which life changes to better suit its environment.

If you think your car runs not off gasoline, but that a gremlin powers it in a little squirrel cage, and that rumbling sound you get when you start your car is the gremlin hard at work — if you think all that, you will eventually run out of gas. And when the tow-truck comes and you explain to the mechanic that your gremlin broke or is on strike, she’s probably gonna look at you like you have two heads, and back away slowly. She might put 5 gallons in your tank and explain that the gremlin needs to eat so you have to keep it in food, and that it really only likes gasoline. After that, you’ll fill your tank when the food-o-meter is close to ‘E’ (which stands for “Especially unhappy gremlin”) and keep it close to ‘F’ (which stands for “Food for gremlin”), and you’ll be on your merry way, operating your vehicle just like everyone else.

But your model of what’s going on is wrong. You might do the right things to keep your gremlin happy, but eventually your complete misunderstanding of what’s going on will fail you. You will be forever unable to repair the engine yourself.

You won’t even know to change the oil until someone explains the gremlin likes to bathe in oil. You see the clean oil going in, and later the same oil come out dirty, and you think, “Yep, the gremlin sure likes to bathe,” and you’ll even take this as proof the engine runs on a gremlin, because who else would be taking a bath in the oil?

And then when someone tries to explain to you how the engine really works, with aerosolized gasoline mixing with air and getting combusted at just the right time by a spark and then exploding and slamming the piston down, you’ll scoff and say, “How does the explosion not blow up the engine? How does the up-down motion of the piston turn into circular motion to make the wheels move? With all that stuff you claim to be in the engine, where’s the room for the gremlin, and who’s taking a bath in all that oil?”

That is where you are right now with DNA, and life, and evolution. You have a model in your head (a model that is ultimately patterned in the physical electrochemical potentials of the neurons and their dendrites). This model has a God driving it all directly. No other model will make sense to you until you entertain the idea that maybe, just maybe, God works in mysterious ways, even in the creation of life. Maybe God didn’t directly write the Word of Life in DNA. Maybe God wrote a life-making machine — the universe — that produces life. Maybe God even subtly guides the evolution of life.

But the evidence that DNA has been around 3.5 billion years is pretty incontrovertible. The evidence that DNA mutates and changes between generations is also incontrovertible. The evidence that these mutations lead to beneficial changes is ironclad — we’ve observed it, seen it happen, and recorded exactly what mutations caused the beneficial changes — or, if you like, the increase in information of the DNA.

You coming here and talking about DNA is if it were some kind of language is just like someone telling the mechanic their gremlin is broken. (This might not be so strange if they drive a Gremlin, of course.) And you seem particularly unwilling to actually engage in a discussion about the nature of DNA. Instead, you seem to want to talk about something else of which you are ignorant, perhaps even more ignorant than you are of evolution: information theory.

Don’t get me wrong, ignorance is not a bad thing. I’ve admitted my ignorance of many things, including abiogenesis. I’m also ignorant of French poetry, organic chemistry, and also vast swathes of the field in which I majored in college: physics. Also, I’m pretty shaky on differential equations.

I don’t try to present myself as an expert on any of these things. Hell, I don’t even pretend to be an expert in my current field of computer programming. I’m not even pretending to be an expert on biology and evolution.

But I have enough of a grasp of these things to have a rudimentary understanding. Much of my understanding of biology and evolution came from reading my mom’s textbooks and the books she read for enjoyment. She was a bioligist, and later a high school science and math teacher. So I read a lot of very accessible books about biology and evolution, and I continued that in college.

If I might be so bold, I recommend you do the same before attempting to debate someone, or before you cut-and-paste “gotcha” questions from the Answers In Genesis website that have been thoroughly rebutted many times in the past — sometimes decades or a century or more ago. If you’d like a good starting point, I recommend Why Evolution Is True, by Jerry Coyne. It’s an excellent starting point for someone with little or no biology education. I imagine you can even find it at your local library, so you don’t have to give money to a Godless Atheist like Coyne.

If, however, you still want to talk about information, try this:

Can you describe a coherent idea or concept that doesn’t include something physical? (Here, “physical” includes properties of physical things, including waves, gravity, and so on.)

nigelTheBold:

November 29th, 2012 at 10:37 am

Ing, quoting the source of all wisdom:

Information itself may be loosely defined as “that which can distinguish one thing from another”

Wow. That is a very concise and elegant definition, though perhaps a bit slippery.

nigelTheBold:

November 29th, 2012 at 10:43 am

Tony:

Nigel:
You’re drunk battling a creationist?

Yeah. I’m an alcoholic. It happens a lot. Thank Gorin for spellcheckers.

Damn, you are good.

Thanks!

Also too: excellent name. I am myself a Tony, IRL.

We Tonys need to stick together. That’s why we have our own theme

theophontes (坏蛋):

November 29th, 2012 at 10:50 am

Jeeez, nobody wants to talk about “noise”.

A question that often comes up, is as to why we do not see abiogenesis about us in this time. What is important is to realise that if, as hypothetical example, clay were to produce components of RNA, these are no longer have the potential as the building blocks of life. They are simply food. That information locked into the microstrata of clay has become irrelevant as circumstances on earth have changed.

/pout

nigelTheBold:

November 29th, 2012 at 11:00 am

theophontes:

Jeeez, nobody wants to talk about “noise”.

Okay, I’ll bite. Stick yer hand out.

theophontes (坏蛋):

November 29th, 2012 at 11:14 am

{holds out paw, razor sharp claws glisten in the moonlight}

There you go…

nigelTheBold:

November 29th, 2012 at 11:20 am

{nigel backs slowly away, attempting to make no noise}

Ogvorbis:

November 29th, 2012 at 11:27 am

theophontes:

Do I even want to know what that is? It looks like a penis with claws.

chigau (無):

November 29th, 2012 at 11:28 am

nigelTheBold
That gremlin in the car thing is genius.
Don’t be surprised if I use it in the future.

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 29th, 2012 at 11:30 am

A question that often comes up, is as to why we do not see abiogenesis about us in this time.

I had a biochem teacher who actually liked to answer that by saying we don’t have any evidence it isn’t. For example if you sealed off a peanut butter jar and waited would you get abiogenesis? His answer is, maybe, but the rate we’re talking about is so slow that it effectively isn’t happening. His point was that biochemstry is actually glacially slow without enzymes.

theophontes (坏蛋):

November 29th, 2012 at 11:33 am

@ Ogvorbis

It looks like a penis with claws.

You do not want to find out. Mwahahahaha…

nigelTheBold:

November 29th, 2012 at 11:34 am

chigau:

That gremlin in the car thing is genius.
Don’t be surprised if I use it in the future.

Thanks. I’d be pleased if you did use it.

Ogvorbis:

November 29th, 2012 at 11:37 am

Oh. Tardigrade. Of course.

Why did I ask?

Ogvorbis:

November 29th, 2012 at 11:40 am

That gremlin in the car thing is genius.

Tell that to AMC.

When I got my current car, I had a nightmare that something had gone all wahoonie shaped with the financing and I had to turn the car back in. We couldn’t get back into our old car as it was already gone so they put me into a car with plenty of room — a stretched AMC Gremlin. I woke up in a cold sweat.

Though it was a refreshingly different nightmare.

Tony ∞2012 recipient of the coronal mass erection∞:

November 29th, 2012 at 11:44 am

nigelTheBold:
Technically, my RL name is Anthony, but I prefer Tony. It’s totes cool to have a song in our honor!

Ogvorbis:

November 29th, 2012 at 11:46 am

Tony:

But ‘Anthony works in the grocery store, saving his pennies for someday!’

Tony ∞2012 recipient of the coronal mass erection∞:

November 29th, 2012 at 11:47 am

A penis with claws…shudder…
Reminds me of the movie TEETH.

Tony ∞2012 recipient of the coronal mass erection∞:

November 29th, 2012 at 11:52 am

Oggie:
Sorry, I don’t get the reference. Kinda par for the course here, for me. I often don’t get much of the discussions here, so I lurk n learn.

Ogvorbis:

November 29th, 2012 at 11:58 am

Tony:

“Anthony’s Song” by Billy Joel. Probably before your time.

Dman kids.

Ogvorbis:

November 29th, 2012 at 11:59 am

And those damn kids can probably spell, too.

theophontes (坏蛋):

November 29th, 2012 at 12:06 pm

@ Tony

A penis with claws…shudder…

Rapex.

strange gods before me ॐ:

November 29th, 2012 at 12:25 pm

Maybe God didn’t directly write the Word of Life in DNA. Maybe God wrote a life-making machine — the universe — that produces life.

joe4060, this is a good time to recommend Ken Miller’s book in addition to Coyne’s.

(After Coyne’s? Before? I haven’t read Coyne’s. Anybody recommend an order?)

strange gods before me ॐ:

November 29th, 2012 at 12:30 pm

Oh Nigel,

At http://pharyngula.wikia.com/wiki/Books,_science you will find Coyne’s book conveniently linked to a library/bookseller search. In this case,

joe4060 click here too: http://en.wikipedia.org/wiki/Special:BookSources/0670020532

Ing:Intellectual Terrorist "Starting Tonight, People will Whine":

November 29th, 2012 at 12:34 pm

If the universe is a life making machine…

Ok everyone remember Futurama with the Professor’s rubber nose making machine? The one that generated about ten tons of toxic waste in order to make a nose that glows in the dark? Yeah if the universe is a life making machine it makes that thing a marvel of efficiency.

Caine, Fleur du mal:

November 29th, 2012 at 12:38 pm

Tony:

Reminds me of the movie TEETH.

I wouldn’t think so, as it was the penises being bit in that movie.

strange gods before me ॐ:

November 29th, 2012 at 12:48 pm

Efficiency! The one true god can afford to do without efficiency. Being extravagant is glorious.

Caine, Fleur du mal:

November 29th, 2012 at 12:54 pm

SG:

Being extravagant is glorious.

Does that include being extravagantly stupid and extravagantly bloodthirsty?

strange gods before me ॐ:

November 29th, 2012 at 1:25 pm

Glory is a generally nasty thing, as far as I can tell, bound up with war and domination. So I suppose the answer is yes.

Tony ∞2012 recipient of the coronal mass erection∞:

November 29th, 2012 at 1:36 pm

Caine:
Sorry. I was a bit vague.
I should have said a penis with teeth reminds me of the movie TEETH wrt to biting genitals…I would not want to be in an intimate setting with either one.

joe4060:

November 29th, 2012 at 3:59 pm

nigelthebold

“Maybe God even subtly guides the evolution of life”

So you are admitting that there is a Creator now?

But why would he need evolution create anything?

strange gods before me ॐ:

November 29th, 2012 at 4:08 pm

joe,

So you are admitting that there is a Creator now?

No. Of course Nigel is not saying that. Please try to be serious.

Nigel is simply trying to explain to you that for you to be intellectually honest, you’ll have to acknowledge that evolution has in fact occurred. If you want to bring your deity along for the ride, Nigel’s not planning to argue with you about that at this time.

But why would he need evolution create anything?

That’s a question you are likely to wrestle with when you acknowledge the fact that evolution occurs. Miller’s book, as I suggested at 159, offers you one option.

But the fact is, evolution occurred (and still occurs), so if a deity is responsible for creating us, then it did so via evolution.

strange gods before me ॐ:

November 29th, 2012 at 4:52 pm

(Apropos of nothing.) Since we’re on page 2, I can make this google-able.

To email strange gods before me ॐ :

http://imageshack.us/photo/my-images/687/51015341.jpg/

http://pharyngula.wikia.com/wiki/Special:EmailUser/Markovbaines

cm's changeable moniker:

November 29th, 2012 at 5:37 pm

“AMC Gremlin”

A 2-door subcompact which, in 1972, came with the option of a 5-litre V8 engine?

WTF?!

Owlmirror:

November 29th, 2012 at 5:38 pm

So you are admitting that there is a Creator now?

My, but you are dim. Of course he isn’t. He was being charitable and positing the hypothetical.

The point is, if some sort of God exists, then just as that God did not create a flat Earth, and did not create a universe with the Earth at its center, so too that God did not create a universe where life did not evolve.

But why would he need evolution create anything?

eyeroll

Why would a hypothetical God that existed need to create an Earth that wasn’t flat, or one that wasn’t at the center of the universe?

nigelTheBold:

November 29th, 2012 at 5:49 pm

joe4060:

So you are admitting that there is a Creator now?

As sgbm and Owlmirror point out, I was simply giving you the benefit of the doubt. I wanted to underscore that you don’t have to give up your belief in God just to accept the reality of evolution and a 4.5 billion-year-old earth.

Me, I don’t believe there’s a God. I don’t see a need for one, and I’ve never heard any reason that rang true for the existence of God.

But why would he need evolution create anything?

Beats me. All I know is, if there is a God, and that God created us, it did so through evolution. The evidence for evolution is overwhelming.

I second sgbm’s suggestion you read Ken Miller’s excellent book. (I have not read it myself, but it’s now on my list, and I have heard very very good things about it.) He’s a scientist who devoutly believes in God.

Now, are you here to discuss evolution, or are you simply going to dodge the issues? I thought you wanted to carry on a conversation about the validity of evolution. That is why you posted all that off-topic stuff over on Greta’s blog, isn’t it?

cm's changeable moniker:

November 29th, 2012 at 6:02 pm

Truly, the past is a foreign country. I learned to drive in a series 2 Fiat 127, with its mighty 0.903-litre engine. ;-)

ChasCPeterson:

November 29th, 2012 at 6:09 pm

Well, the Gremlin was just the front half of a Hornet, and that was pre-energy-crisis.

cm's changeable moniker:

November 29th, 2012 at 6:12 pm

But why would he need evolution create anything?

Why would he need plate tectonics to create mountain ranges and ocean basins? We can measure Europe and America getting further apart. We can measure Europe and Africa are getting closer together. We can measure Baja California sliding into and past northern California. We can see the subduction zones and the volcano arcs of the Pacific rim. We can see the mid-Atlantic ridge and the basaltic flows in Iceland.

This all seems a really complicated (and costly: lives lost to earthquakes and volcanic eruptions) way of making some interesting scenery. Surely an all-loving god could have just made the earth the way he wanted it and left it alone?

PZ Myers:

November 29th, 2012 at 6:15 pm

Arrr, NEW THREAD!

[Thunderdome]

Share this: