Comments

  1. Narf says

    This video has some A/V sync issues. Sorry.

    WHY CAN’T A BUNCH OF PROFESSIONAL, PAID BROADCASTERS MANAGE TO …

    Oh yeah, wait a minute.

  2. Patrick67 says

    @Narf: Late this past Sunday evening I thought I might check the Archives to see if the mpg.3 audio for this episode had come up yet and lo and behold, I found that there was a copy of the video all ready up. The mpg.3 wasn’t even there yet. I thought to myself it was unusual. Anyway, I went ahead and clicked on the video and watched it and I swear it played absolutely flawlessly. Super sharp video and perfectly synced audio. Afterward, I read for awhile then went on to bed. When I woke up in the morning I decided I’d re-watch the fool on the end of the video. I went to the Archives and the video was gone. It just came up again not long ago today. I notice now the sound is a little out of sync. I’m just not sure what happened between late Sunday and today.

    Despite the slight audio glitch, the over all production is worlds better than the past few weeks. Kudos to all who are working behind the scenes and keep it going in the right direction.

  3. frankgturner says

    It’s been a while since I posted but good grief did the caller Chris not have a clue how to form a coherent question.
    .
    Maybe we can get more through to him if he comes in here. I doubt that he will comprehend though. He seems to want evolution in a bottle, something oversimplified.

  4. Patrick67 says

    Doubting Thomas! Doubting Thomas! Doubting Thomas!
    I don’t own a firearm, but I swear to (insert mythological deity here), If I had to hear Chris mention Doubting Thomas one more time, I would have seriously considered going out and purchasing one.

  5. Narf says

    @Patrick67
    Huh, I dunno.  I’m not sure what goes on behind the scenes at the studio.  I’ve never been to Austin.& I prefer Chicago weather … although for some reason, I’m down here living in a swamp.

    I hope it came through that my initial post what mocking all of the idjits in the last few posts, screaming about the quality of the show and demanding that the show replace the engineers with better ones and upgrade all of their equipment?  And I quote from mando:

    Come on guys, it takes like 3 hours to resolve connection/audio issues. You guys need to man up and updgrade all your equipment. If you staff is not technologically-savy then UPGRADE YOUR STAFF. Man, so irritating listening to a show that has great conversation and is diluted with horrible audio.

  6. Narf says

    Cool. Sometimes it’s a little hard to tell, in text form, although I think I laid it on heavily enough in this instance that it’s really freaking hard to miss.

  7. frankgturner says

    @Narf #6
    I am not sure if I understand what you are getting at but I have an idea. Could you expand please? (I think that I get you but I am not sure).
    .
    @Patrick67 #4
    It is a bad analogy. I would have explained why myself if I were there but I am guessing that Chris is too thick to get it.

  8. Narf says

    @fgt
    Chris is as dense as Bobby, so if Chris showed up here on the blog, we’d end up with a Bobby-clone, going through similar arguments without any comprehension on his end.

  9. favog says

    Okay, I’m only one call in. Matt missed a great opportunity to do a call-back to a point he tried to make early in the discussion that would, I think, have been helpful to the caller. When he got to the example of the homeless person, Matt could have reminded him that in the situation, there are multiple options to take. Only one of them is the most moral of those options, and the one the caller was trying to hypothesize as being a potentially moral option is NEVER that optimal selection. Even if you yourself are not able to do something to help the homeless man, and make his life better, that painless execution prevents someone else from doing so. Even granting the caller’s scenario it’s most positive possible read, “amoral” is the best judgement one could hope for on it. And even that’s a pretty hard sell.

  10. favog says

    And yeah, that last caller is twit. Describing himself by analogy as “Doubting Thomas” fails because he’s basically saying that he rejects anything that’s “just a claim”. But the way he categorizes a claim, he’s got to go and get a degree himself and discover all the evidence and proof on his own or it’s “just a claim”. Imagine the story in John, but Thomas wants to put his fingers in the wounds … but Thomas has no fingers, so there can be no proof.

  11. Monocle Smile says

    @favog
    That first caller was almost as painful as Chris. Had he never even thought about this shit before? I feel like morality isn’t that hard and people like the caller want to make it into a science fair. I don’t get it, and I didn’t get it when I was a believer. And I REALLY don’t get how they think having a god changes anything about the topic.

  12. Monocle Smile says

    Chris’ call was very typical of the narcissistic man-child notion of “Everyone else MUST be wrong even though I don’t know anything about anything.” It’s like he had never set foot in a school before. The teenage libertarian bullshit at the end was an incredible cherry on top. These people breed, folks.

  13. holomorph says

    The caller is wrong in stating that his scenario does not cause suffer. If you kill a homeless man, just for fun, you always will cause harm. That’s even true if the man does not suffer and has no family or friends. It still causes suffering in the society, because now all people must fear becoming homeless and lausing all relatives and friends and then being killed just for fun. This has desatrous consequences for society and causes huge amounts of suffering for all people.

    It may be that there are acutally scenarios where reducing ethics to a reduction of suffering is not sufficient – this scenario doesn’t show this, however.

  14. frankgturner says

    @Narf #10
    Thanks. I thought that might be what you were getting at but was not sure.

    @ Lots of people
    When Chris said the line about “one thing turning into another” and punctuated it by calling them “evolutionists” or “Darwinists” and seeking to think that atheism was synonymous with evolutionary biology (he is likely unaware of Kenneth Miller and I am glad this was mentioned), it keyed me into the idea that he had a lot of misconceptions that need to be “undone” before he can get an understanding.
    .
    @ favog #12
    The story of people trying to “disprove” evolution by going to get an understanding of it by studying biology and in the process coming to understand and accept it is not an uncommon one. It’s not so unlike individuals reading the Bible and becoming agnostic/atheist.
    .
    I know one story on an engineer who metaphorically “stuck his fingers in the holes.” He was observing nanobots who would build replicas of themselves to help engage in their ultimate programming to complete their goals. He noticed that the nanobots that did a better job building replicas tended to thrive better and became a larger part of the population. Kind of an interesting story and I wish that I had a link to it.

  15. corwyn says

    @12:

    I don’t know, one can actually go examine fossils. If one shows that one is careful and serious (bring your own gloves), one could perhaps touch the fossils. One can examine the output of DNA sequencers personally, and compare them personally to others. I think Matt and Jen should have emphasized more that the actual physical evidence is available to anyone who evinces a desire and scholarship.

  16. Peggy says

    @20:
    That probably wouldn’t help this guy. He would probably look at the fossil and say that it isn’t doing anything. He needs to see evolution happening before his very eyes in real time.

  17. gshelley says

    I thought the hosts didn’t handle Chris well. Once it was clear he was going to dismiss any evidence produced or collected by someone else, they should have asked him what sort of evidence he would accept.
    Given his lack of interest in also performing those experiments or tests himself, I can’t imagine there would be anything, but at least they wouldn’t have been going round in circles.

  18. says

    The Story of Doubting Thomas, According to Chris.

    Thomas: How do I know you’re really the Jesus who was crucified?

    Jesus: Here are my hands, and here is my side. See the wounds? Touch them for yourself. You’ll see they’re real.

    Thomas: (Averts eyes) That’s just a claim.

    Jesus: No, seriously, you can check them yourself. I’m showing you, right here, where they are.

    Thomas: Yeah, but I shouldn’t have to actually *do* anything. You’re asking me to look, and to touch for myself, and *claim* I will discover they’re real. But you need to prove those wounds are real by providing evidence, and if you can’t do that without asking me to actually *examine* the evidence then it’s just a claim.

    Jesus: Just reach out your hand, and open your eyes. You don’t have to believe my claim that they’re real wounds, because you can check for yourself!

    Thomas: That’s just a claim.

  19. Narf says

    @holomorph

    It still causes suffering in the society, because now all people must fear becoming homeless and lausing all relatives and friends and then being killed just for fun. This has desatrous consequences for society and causes huge amounts of suffering for all people.

    This is something that lots of people leave out of their calculations of moral behavior.  What impact will allowing the behavior to become normalized have on the society in which that behavior takes place?

    The only time that Christians seem to get this point is in their most insane histrionics about gay marriage … and even legalizing homosexual behavior, for the most insane ones.

    Of course, the big problem there is that they’re just fucking wrong.  Allowing homosexual behavior has no impact upon anyone else’s sex life, and I think that deep down, the anti-gay bigots know that; and allowing gay marriage has no impact upon anyone else’s marriage, and I think that the bigots know that, too.

    If I may pull the Hitler card, for a moment …
    If Hitler had been correct that every single Jew in the world was a degenerate who was bent on the destruction of society and was responsible for every ill in society, straight from the cradle, he might have had a point.  As it was, the man was either evil as hell or completely insane.  The mere idea that an entire category of people could be anything, except perhaps in the most strictly biological sense, is completely fucked.

  20. ironchops says

    @ 20 Peggy
    I agree. According to the bible, there will be some people that just simply will not believe, even in the face of great miraculous deeds such as raising people from the dead. I guess it works both ways huh.

  21. Narf says

    @ironchops

    I agree. According to the bible, there will be some people that just simply will not believe, even in the face of great miraculous deeds such as raising people from the dead. I guess it works both ways huh.

    Well, if you aren’t willing to believe the miracle of speaking in tongues and casting out gay demons, which the Pentecostals do, I guess nothing will satisfy you.

  22. Peggy says

    @27: Gee, that’s funny, Narf. So true. These folks who equate actual evidence of real life with miracle stories in their big book of fairy tales or the stage magic of demon exorcism are either very funny–or very sad. “Yes, Jesus really rose from the dead–there were WITNESSES!” And Frodo really went to Mordor. Samwise was there and witnessed the whole thing!

  23. ironchops says

    Caller 1-Eric from Georgia, Murder is wrong. Mat and Jen, Comfort measures to ease the suffering of the terminally ill is beautiful, even if a lie helps to give comfort. Jen, tough decision!
    Caller 2-Mike from Virginia, I have been struggling with this exact same problem. I live in Yorktown, Va. I agree with the advice about trying to find secular groups in your area however I still attend church. God created the universe but the Devil made it look old-hehehe.
    Caller 3-Chris, There are many claims but some are backed with hard evidence and other claims are backed up by mere bullshit (god). You have to decide which is which. Wake up! Smell the roses!

  24. Narf says

    Yeah, I just had this one idiot who I told that he wasn’t worth talking to, after he repeatedly told me, “No, this is what atheists do!  They just attack Christianity, not religion in general!  Even the ones in India and in the Islamic world.”  He never quite explained how or why atheists in India are persecuting Christians and ignoring Hinduism and the mystics who are roaming the countryside, conning ignorant villagers out of their money.

    http://www.patheos.com/blogs/reasonadvocates/2015/08/29/religious-faith-is-belief-without-evidence/#comment-2232035805
    I only bothered reading the first few paragraphs.

    How do you talk to someone who’s either that aggressively ignorant and stupid or is that dishonest?  It’s one or the other.

  25. ironchops says

    Peggy & Narf
    My mom is Pentecostal and when they start that portion of their service I have to bite the inside of my cheek to keep from bust ’n out laughing. Mindless babble. The funny part is when the interpreter comes up with what it meant. I mean damn! Crazy talk!
    Ya’ll do know that I lack belief in this mumbo jumbo.

  26. frankgturner says

    @ Peggy #22
    The point of the game is that you do see something in real time going through the process, reproducing itself with similar, albeit imperfect traits and subsequent generations going through the same process.
    .
    I was getting the impression that this guy thinks evolution is like something out of pokemon where a dog will become a bird or some other crazy misconception like that.

  27. guyblond says

    The new production values are not quite good enough, but they’re getting better. I don’t think that many folks realize how expensive these productions can be. Working with volunteers and equipment that is affordable for a non-profit is a real challenge. So people should just give these fine folks some slack.

  28. corwyn says

    I would like to see someone give a lecture on evolution to creationists which doesn’t try to bludgeon them with ‘fact’ and ‘peer review’ and ‘scientific consensus’, but rather starts by asking them if they agree with some basic things.

    1. “Do you agree that all humans are different?”
    2. “Do you agree that humans tend to resemble both of their parents, but not exactly?”
    3. “Do you agree that some of those differences are contributing factors in when a human dies?”
    4. “Do you agree that some of those differences are contributing factors in how well a human thrives?”
    5. “Are you willing to concede that the same is true of other animals?”

    If you answered ‘yes’ to these questions, congratulations, you are a Darwinist.

    ***

    For the question of ‘new information’ coming from a random process consider:
    *CTTCAGCACGCTCACGGCCTT*
    This is either a chunk of the human genome (perhaps it codes for a protein, perhaps it doesn’t), or a sequence of C,T,G,A that I created with a 4-sided die.
    Can anyone determine which? If one contains ‘information’ and the other doesn’t, it should be easy to tell, yes?
    If I change one of the letters have I added, subtracted, or kept the amount of information the same? If I add another letter to the end have I added information? Does it matter if I used the letter that followed from the actual human genome(if it was), or used a letter from another part of the human genome, or generated it randomly? How could you tell? What if that sequence appears multiple times in the human genome, but each such sequence is followed by a different letter (all four are present); what happens if I add a *random* letter? We still have a sequence from the human genome, we now know which of the four it is, do we have more information?

  29. Narf says

    @ ironchops
    I’ve been to several Pentecostal churches, myself. I find them funny, if a bit surreal.

  30. Narf says

    @fgt

    I was getting the impression that this guy thinks evolution is like something out of pokemon where a dog will become a bird or some other crazy misconception like that.

    Ray Comfort and Kirk Cameron say exactly that.&nsbp; They even have a ‘joke’ that evolution says that that’s what a bird-dog is.

    And don’t forget the Crocoduck.

  31. frankgturner says

    @ Narf #37
    I know they do. Like I said, it seems to be a common misconception and the fact that it is trouted out by the hill Billy leaders of said creationists like Banana Ray and Kirk-off supports that commonality.
    .
    I would not be surprised if the caller was familiar with that BS and thought that it was somehow meaningful.
    .
    @corwyn
    Some don’t recognize that humans are animals.

  32. says

    Doubting Chris was a rigid blowhard.

    Re caller No. 2 and Pascal’s Wager: Matt pointed out, as he often has, that if there were a God, and it operated as described in the Holy Bible, it would be a malign thug and therefore not worthy of worship.

    No doubt. But I think what people with a vestigial (or all too present) fear of hell are thinking is, “Well, sure, but the motherfucker can still torture me for eternity, and against that, my pride in now bowing down to the thug will be cold comfort indeed.”

    I’ve said for years that die-hard Muslims are the only ones who really take Yahweh/Allah seriously. Islam means “submission,” in if the goal is to avoid suffering, pain and torment, then absolute submission is a very rational choice to make for someone who believes in such a god.

    In short, if God exists and is “all powerful,” then it can do whatever the hell it wants to anyone or anything, which gives some believers all the reason they need to “believe” (even if they don’t).

  33. Narf says

    @CBE
    Since that god commanded them not to lie, you’d think he would be a little nonplussed about them lying to him about believing that he exists.

  34. Monocle Smile says

    @Narf, #30
    How in the shit did you decipher that post? See, people like that aren’t worth engaging. On occasion, Patheos gets some theist traffic that sparks good discussion, but that dude types like he’s taken a sledgehammer to the face.

  35. favog says

    My point in 12 was exactly that the evidence is there for him to touch, but that he won’t because he’s found it easier to dismiss everything as “just a claim” that way. He is refusing to understand that there’s a difference between a claim that isn’t backed by evidence, and a claim that is an introduction to the evidence. I must’ve been unclear in my statement.

  36. Narf says

    @MS

    How in the shit did you decipher that post? See, people like that aren’t worth engaging. On occasion, Patheos gets some theist traffic that sparks good discussion, but that dude types like he’s taken a sledgehammer to the face.

    Well, that’s why this was my final comment to him:

    “Dude, you dictate to us what we believe, and you won’t be moved from your fucked up presuppositions.  You insist that atheism is a religion, which is fucked, and you insist that atheists only attack the oh so persecuted Christian majority in this country.
    There’s a certain point that people aren’t worth talking to anymore. You’ve hit that point.”

    As for the comment I linked, I didn’t really bother.  That post was something like the third one in which he proclaimed that atheism is a religion and the bit about us only targeting Christians, worldwide.  I think I read about the first 2 or 3 blocks of text of the response I linked, before I said, “Yeah, fuck this guy.”

  37. frankgturner says

    @ favog #43
    I actually understood you earlier and I have been hinting at an extension of that point. The evidence for evolution isn’t just one thing that you can touch because evolution is a multi faceted concept with many different things to touch. If he wants it in a nutshell he is not going to get it. The times when I have seen a metaphorical “wounds to stick your fingers in”, what is essentially something that got a skeptic to believe, it was something complicated like an engineer studying nanobots. I was talking about this at work and the classic dark skinned moths example in England came up, which was observed and documented.
    .
    The other issue is the misconception that evolution is some form of individual metamorphosis, which it is not. Un-teaching this from that “rigid blowhard,” (of I may use that CBE, thank you) is likely more difficult.

  38. Patrick67 says

    I have been watching the discussion about Chris as it has developed over the course of this thread and I think I’m in general agreement with the folks here. I feel a special frustration with Chris and the first caller for very personal reasons. I feel a rant coming on so I hope all will be patient with me.

    I am an older gentleman who over the course of his lifetime became more nonreligious as the years passed. Actually I suppose it’s a case that I was never that religious to begin with. I grew up in southern Indiana in a very conservative state, yet I never had the deep conservative upbringing in either family life, school life, or religious life. I was heavily influenced by a church denomination which I will let remain unmentioned for the time being. Btw, I will just say that that denomination is a big supporter of SSM today. It was a denomination that was filled with very learned pastors, especially when compared to Apostolic. Pentecostal, or Southern Baptist churches. All the pastors that I ever dealt with were very well educated men. They all had a firm grasp of evolution and geology, even paleontology and anthropology as presented at that time in history. Several of them had extensive libraries on what was then modern science. And for the most part they seldom mentioned God or a Creator when discussing such subjects. I was just never exposed in church to young creationist and anti evolution dogma. In my church at the time I was surrounded by science, math, and English teachers; factory workers, farmers, doctors, and lawyers. If all of them weren’t highly educated, they were all well read. I was never forced to, or expected to believe anything that I couldn’t believe willingly. I’m not sure if many of you experienced that in a church environment before.

    Like I said earlier, as time passed I just fell more and more away from the religious aspects in my life. Even today, I have a hard time whenever any one comes on the APx trying to tie morality to any religion. I think that while I was influenced by religion in some ways, in the truest sense, my morality was never influenced by religious doctrine. It developed on its own. I instinctively seemed to understand what was right and what was wrong. I always had a instinctive feel for what was fair and just. I always just realized that abortion rights was the correct way to go, that racial equality was the correct way to go, and that in today’s sense, that SSM’s time had come. I never had to be told any of this by a God or a church. I made those decisions on my own.I’ve never even felt my parents had that much influence on me. I’m not sure if anybody else has felt that same way.

    As for Chris and his inability, or most likely his simple refusal to understand what Jen and Matt were trying to explain, his kind just drive me up a wall. If you can’t find evidence for or against something, especially evolution, then you just aren’t looking for it. I was exposed to The Origin of Species when I was visiting a common farmer who allowed me to borrow it from his own private library. While certainly not all, much of what I have learned about geology, evolution, cosmology, anthropology, paleontology, and archaeology, found its root on the daybed in my grandfather’s family home. Grandpa’s old farmhouse was originally built as a log cabin in 1820. It was later enclosed by framing and a huge kitchen and back bedroom were added on. No electricity ever touched that home. Water was drawn from a hand pump located outside the back door to the kitchen. The potty was a two-holer located at a safe distance from the house. Light was provided by kerosene lamps, heat by potbellied stoves and cooking was done on a huge wood burning kitchen stove with more burners and ovens than anyone should ever be forced to imagine. And in the parlor there was an old secretary that had a fold out desktop. Inside that secretary was an early but unfortunately not first edition of Audubon’s Birds of America. There was a Civil War era medical book that was the top of the line for treating diseases of the time and filled with detailed illustrations of all kinds of surgery and used for teaching the latest medical practices. Also there were books on proper writing techniques, post Civil War math books and several dictionaries and a thesaurus. Across the room by the daybed was an orderly stack of countless volumes of Scientific American, Nation Geo, Reader’s Digest books dating from the 1930s forward, filled with what was then the latest articles on plate tectonics, the discovery of Lucy, the first articles written on the KT boundary discoveries and the meteor strike that was later found to hit the Yucatan area. I cut my teenage teeth pouring over those magazines. I later located two very fine University level geology museums to explore, and I very quickly found out if you approach a professor or even an assistant and complement their place of study you can easily find out more about evolution and related sciences than you ever care to know.

    I’m sorry for my trip down memory lane rant folks. But to make a long story short, in the case of Chris, the evidence on evolution is out there if you truly care to find and examine it. It’s not really that difficult even if you don’t have an advanced degree. But be forewarned, no matter how hard you look, the evidence will never contain a crocoduck.

  39. Winston Stableford says

    Hi Guys. I haven’t finished listening to your entire archives yet. I’m impressed by the number of callers who want to invoke quantum mechanics without being able to do quantum mechanics. Granted it’s a tough little bugger but if all you know about what it does and doesn’t say is from third parties be very careful about who you use as an authority. Anyway. Just wondered if – relative to the something from nothing argument – you’ve discussed the Higgs Field on any show and if so, could you point me in that direction. Thanks.

  40. ironchops says

    The fact that we are here talking about miracles , god or a lack of god is either a miracle, or a serious stoke of luck!!

  41. Monocle Smile says

    @Narf
    Again, Greenwood both dishonest and intellectually lost. He’d understand why his kindergarten epistemology is crap if he bothered to apply it to any other religion. Of course, loads of apologists are obsessed with special pleading, so it’s unsurprising to see him fail that hard. And of course, there’s the typical projection of “you read the bible looking for reasons not to believe.” They seriously think they can take their crappy belief system, merely change the nouns, and then get atheism. Not how it works.

  42. Narf says

    At least he isn’t a much of an asshole as that guy, skwills. who’s still going nuts over in the comment section of Aron’s second post.  I’m about half way through the response to his latest post, but I have to run off somewhere for 6 or 7 hours, in a few more minutes.  I’ll see if I can finish it later tonight.

    That’s exactly where I’m going with this, what you said about the comparison to other religions. Alien Abductions … someone’s present-day claims about interacting with a god other than his own. It’s all potential use in possibly getting through to him how much special pleading he’s engaging in, with his exclusive credulity that he applies only to the claims of Christianity.

    His bit about the court case is also pretty fucked up.  I’ve already written most of the stuff addressing that, except for possible editing and the addition of a few details.

    If I understand what you are getting at. Then I see a role reversal here of who is the prosecution and who is the defense. That certainly makes a difference in a trial! If the accused is Jesus then the prosecutor has to prove his case. Correct? If I am placed in the role of prosecutor then I have to prove that you are guilty of not accepting the evidence as presented?

    This is why the courtroom analogy isn’t perfect.  All analogies break down at some point.  You’re thinking of Jesus as the defendant, because he was a human (depending upon which version of the early perspective of Jesus you believed, before they settled on the hypostatic union) and the prosecutor in pretty much all criminal cases is the nebulous state.

    Jesus is not the accused, because no one is making a claim against him.  Well, I guess the Jews and Muslims make some claims against him, but I’m not.  I simply don’t accept the stuff written about him in the Bible.  He (ie. you) has to provide evidence to support the claim you’re making, however you want to phrase the claim you’re making … against me, I guess, if you want to extend the analogy to ridiculous lengths.

    In a normal court case, the prosecution is presenting a case in order to eliminate reasonable doubt of the defendant’s innocence.  In this case, you also have to provide evidence in order to overcome that reasonable doubt.  I have a bit more than reasonable doubt, but that doesn’t matter, because I’m not trying to prove to anyone that Jesus absolutely never existed.  I have no problem imagining an itinerant rabbi roaming the Levant preaching, around 30 or 35 CE.  It’s the stories about his activities that have almost certainly been stretched out of recognition by mythologizing, between the supposed events and the recording of those stories.

    There’s also an interesting case presented that argues against him ever having existed, but I’m not sure I particularly swallow that argument.  I have to look into it a lot more.

    My position is that it’s irrational to believe most of the stuff in the Bible as more than just stories, because there simply isn’t the evidence to back up its claims. There’s some corroborating evidence to support the mundane bits of the latter half or so of Old Testament, but the first half or so of the historical books of the Old Testament and the entire New Testament are unsupported.

    I do want to have a day in court where I can plead innocent for Jesus, proving His resurrection and giving evidence to back it up.

    And what are you going to prove him innocent of?  I’m not making a positive claim against him, so you have no claim to defend him against.  Pleading innocence doesn’t get you to proving his resurrection.  You’re still trying to support a claim, so you still have the prosecutorial side.  What you’re proposing doesn’t fit with the way that logic works.

    I would like to prove that the four biographers of Jesus are likewise of innocent of perjury.

    You have nothing to prove.  I don’t say that the authors of the Gospels committed perjury.  They didn’t write any names on the Gospels.  They’re anonymous.  The names of the apostles (or were they disciples at that point?  I can never keep those straight) were added to the books sometime in the second century to lend the writings apostolic authority.

    I don’t know that I would say the writers had committed perjury in the content of their writings, either.  They might have believed that what they were writing down was the truth, since they were just writing down the stories that had been told to them by other early Christians.  There’s no reason to think that the stories could go more than three decades without serious distortion, addition, and mythologizing.  In our modern era, such distortion occurs even with the aid of recording.  It’s ridiculous to think this wouldn’t also apply to the ancient world.

    Whereas in your courtroom you can rule out the four biographies of Jesus (the gospels) as being inadmissible. Is that right?

    They’re inadequate as evidence to weight things in either direction, yes … except for the parts that we know that early Christians forged, probably to settle disputes in the early church, such as the passage in Luke that describes Jesus sweating blood and the Pericope Adulterae.  The passage in Josephus also demonstrates that early Christians were willing to forge passages in support of their religious convictions.  Then there are the last 11 verses of Mark, which were also apparently added on later.

    These later additions and the forgery in Josephus – and the forgery of many of the letters of Paul’s supposed writing – don’t exactly speak wonders for the universal honesty of early Christians and a reason that we should accept what they wrote at face value.

    ———-

    And yes, it needs a lot of cleaning, after I finish the rest of it.

  43. Narf says

    But yeah, I love the bit where he says, “I do want to have a day in court where I can plead innocent for Jesus, proving His resurrection and giving evidence to back it up.”

    Uhhhhhhh, dude.  You’re the one who brought up the court analogy, and you don’t understand how courts work.  We’re going nowhere, if you don’t understand the basics even that much.  Real courts don’t work like Perry Mason, in which you get to stand up and point to the person who actually did it, at the end of the show.

  44. Kasper says

    In correlation with pascal’s wager, I wonder why you dont mention that following a belief/god (whatever that may be), may be a worse use of your time than not believing. So there are downsides to believing besides the possibility of being wrong about which god to believe in.

  45. frankgturner says

    @ Narf
    It has been a while since I signed into my disqus account. Do you think I should take a crack at explaining to him (Greenwood I mean) how the courtroom analogy works/applies to this situation?

  46. EnlightenmentLiberal says

    I was getting the impression that this guy thinks evolution is like something out of pokemon where a dog will become a bird or some other crazy misconception like that.

    AFAIK, that’s very common amongst anti-evolution creationists. Creationists are often asking for a crocodile turning into a duck, which gives us very funny jokes like the crocoduck.
    https://en.wikipedia.org/wiki/Crocoduck
    It’s based on the creationist Biblical notion of separate and immutable “kinds”. Specifically, animals of one kind never turn into another kind. Oftentimes, I’ll see pro-evolution people say that the creationist is wrong, and that one kind of animal does turn into another kind of animal. Unfortunately, that’s mostly wrong, and counterproductive.

    According to evolutionary theory, it is true that one kind of animal never stops being that kind of animal. It’s basic phylogeny. Descendents of mammals will always be classified as mammals, even if they are not warm-blooded, don’t have hair, don’t produce milk, etc. However, their ancestry from other mammals will be evident from examining the skeleton and other body structures, and their ancestry from other mammals will be evident from an analysis of their DNA. Once a mammal, always a mammal. The creationists are entirely right with their claim that one kind of animal never turns into another kind of animal – taken at face value, and taken literally.

    The actual problem with that creationist refrain is the hidden assumption that animal kinds are an exclusive and mutually non-overlapping categorization of animals. That’s what’s wrong, and we need to attack that notion IMO if we want to explain proper evolution to a creationist. A dog is a kind of mammal, and a mammal is a kind of tetrapod (loosely: four-legged animal), and a tetrapod is a vertebrate (loosely: animal with a backbone), and a vertebrate is a kind of animal. A duck is a bird, and a bird is a kind of tetrapod, and a tetrapod is a kind of vertebrate, and a vertebrate is a kind of animal.

    When we categorize animals according to their body shapes, and when we categorize animals according to their DNA, we see that some animals are more closely related to some than to others. We can create a series of buckets. We then find that some buckets are more closely related to other buckets, and we can make buckets of buckets. We then find that some of these new buckets are more closely related to other buckets, and we can make buckets of buckets of buckets. This buckets in buckets result is exactly that of a family tree.

    Animals of one kind never stop being that kind. However, one kind of animals can and often has diverged into many new kinds – many new sub-kinds. The new kinds are still members of the ancestor’s kind; they’re also members of new sub-kinds.

  47. Narf says

    @fgt
    Give me a little longer to get my response back to him, if you would.  Feel free to pile in, after I get it up, later tonight.

    I’m Joseph, on Discus, which I assume you figured out for yourself.  I’ll keep my last name to myself right now, though, until I get can myself out of the workforce.  You never know what will pop up on Google.  There are … I think it’s 107 people in the US with my last name.  103, 107, 109 … something like that.

    My girlfriend wants to marry me mostly for my last name, since it will do wonders for her Google placement.  Richardson just isn’t doing it for her, for placement purposes.  I think there are three people in Europe with her exact same name, who are well-published scientists.  She doesn’t have a chance in hell of first-page placement, with that kind of competition.

  48. Kristian says

    Chris wasn’t a doubting Thomas but a Filibustering Thomas. He wasn’t interested in evidence but simply disrupting and denying.

  49. Narf says

    @fgt
    Well, last night lasted a little longer than I thought it would.  I’m working on my response right now, Frank.  I’ll let you know when I’ve finished it.

  50. corwyn says

    Whereas in your courtroom you can rule out the four biographies of Jesus (the gospels) as being inadmissible.

    Actually, yes. The gospels are hearsay evidence, and thus inadmissible.

  51. Narf says

    @Kristian
    Yeah, I like Matt’s analysis of the situation, after they hung up on the jerk-off.  Something to the effect of, “I know you’re not seriously interested in knowing about evolutionary biology, because if you were, you would have talked to evolutionary biologists, paleontologists, or someone else who works with this stuff professionally, not an atheist show.”  Of course, from his repeated use of the term Darwinism, I imagine Chris would have no idea who to contact for professional information nor how to find them.

    Hell, if you’re willing to dismiss all of the findings of science (which is essentially what Chris’s approach would do, if he applied it consistently), I just don’t know what to say to you.

    At least the second caller (whose name I’m completely blanking on) was good.  That was one of the most interesting, productive calls from an atheist that I’ve heard in a while.

  52. says

    Since I’ve been homeless for 3 years, I really hope the first caller’s weird moral calculus doesn’t catch on. I don’t want people going around thinking they can kill people like me as if it’s a good thing to society. Rings very terrifying, actually.

  53. JD and Co. says

    The caller seeking to break free of his Christian chains was heartbreaking in his honesty. Best non-theist call in a long time! Matt’s reply of “Seeking to affirm what you want [to be true] is not the way to go about life” was SO right on.

    And the guy who kept calling them “Darwinists”? Way to reveal your true agenda, dude.

  54. Narf says

  55. Narf says

    Meh, my previous message with the comment-specific links got caught up in moderation.  I guess that 5 in one comment is still too many.  I e-mailed Russell and Martin to see if one of them feels like doing moderation duties and giving it a kick, but I have no idea when they’ll do that.

    Here’s a link to my profile on Discus: https://disqus.com/by/disqus_lFxURgKLOV/.  The top five comments on my profile are the comment I just posted.  The first and fifth one are just cappers.  The middle three are the comment itself, which I had to break up, because I cooked the character limit.

    Read them in reverse order, of course, since it’s newest comment at the top.

    All yours, Frank.

  56. says

    my (hopefully) overactive imagination had me imagining the first caller in some secluded park with some unsuspecting homeless fellow he’s just befriended, playing out his “hypothetical” with matt and jen while fingering the pistol in his pocket and wondering who’s smarter than who …

  57. Monocle Smile says

    @Narf
    I know I don’t always choose my battles wisely, but I feel like this is wasted effort. I don’t find any benefit in arguing with someone who is dishonest and refuses to admit error.

  58. Narf says

    @MS
    Most likely, but I can use it as useful material for other things.  I have some stuff in the works.

  59. Narf says

    @62 – JD and Co.

    And the guy who kept calling them “Darwinists”? Way to reveal your true agenda, dude.

    That guy — besides just being an asshole in general — was probably also profoundly ignorant of what atheists in the ‘atheist community’ actually know of Christian apologetics and fundamentalist Christian bullshit in general.  Perhaps he thought he was being original or at least was repeating apologetics that Matt and Jen hadn’t heard before.  Although, I must admit, the “Any science that disagrees with my religion is just a claim,” stuff is new to me, mostly because it’s probably too stupid for even most fundamentalist Christians to use.

    A lot of Christians just don’t understand where we’re coming from at all.  They think — mostly because they’ve told by their preachers — that the only reason to not be a Christian is ignorance or suppressing the truth in our unrighteousness.  I got that explanation pretty explicitly from the guy I’m arguing with, on Aron’s blog.  He’d never had to deal with someone who had read William Lane Craig’s bullshit (although he didn’t phrase it as such, obviously) and had a different opinion of him, so therefore, anyone who has a negative opinion of WLC obviously doesn’t know anything about him or his writings.  So many Christians are so freaking isolated from any alternative worldview.

  60. Narf says

    Whereas in your courtroom you can rule out the four biographies of Jesus (the gospels) as being inadmissible.

    Actually, yes. The gospels are hearsay evidence, and thus inadmissible.

    A bit more concise than I put it, yes.  I doubt he would have understood something so simple and straightforward, though.

    Despite being the one who brought up the courtroom analogy, he doesn’t seem to actually have a fucking clue how courtrooms work.&nbsp When he said, “I do want to have a day in court where I can plead innocent for Jesus, proving His resurrection and giving evidence to back it up,” I just kind of stared at it for a minute or so, dumbfounded.  Plead innocent … for Jesus … proving his …

    Wait …

    Plead innocent …

    Proving …

    What the fuck?!?!?!?!?

  61. EnlightenmentLiberal says

    @Narf
    I don’t know how much I’ll want to participate in the comments on Aronra’s new blog. Disqus comments are fucking evil. I have no idea why anyone would ever want nested comments for a high-volume website – especially when the nested depth is limited to like 4. Several of the conversions become nigh impossible to follow because the comments are shown in a seemingly random order.

    @AXP
    Again, let me take this opportunity to thank the guys who run this blog for taking my suggestion of no comment nesting, chronological order only. It means I can actually follow what is going on.

  62. EnlightenmentLiberal says

    Specifically – for disqus, the display depth is capped at 4, but the actual nesting depth is unlimited, which means you have a highly complex tree where all depths >= 4 are capped to 4, which means that at first glance, all of the comments at depth 4 are in a completely random order. Even here it was never that bad. At least when we reached max nesting display depth, all of the comments in a particular sub-thread were shown in chronological order, unlike disqus.

    Disqus is one of the worst pieces of widely used software from the user perspective that I’ve seen in quite a while.

  63. Narf says

    @EL
    Yeah, the formatting for the site is kind of fucked.  On the blog itself, you can’t even see most of the comments.  I had a few times when I flipped up and down through the comments, trying to figure out where the hell something had just gone, until I figured out what was going on.  It’s kind of problematic.

    @AXP
    Again, let me take this opportunity to thank the guys who run this blog for taking my suggestion of no comment nesting, chronological order only. It means I can actually follow what is going on.

    I think that was mostly Russell.  Good call, Russell.

    Yeah, you get the occasional scramble with references to post numbers when comments from new commentators are approved, but if you properly quote material from the comment that you’re responding to, if the comment is more than one or two above yours, it works out well enough to easily decipher what is going on.  It’s a hell of a lot better, over here, even if the quality of our theistic commentators isn’t particularly better.

  64. Narf says

    K, I tossed your comment in on the end, Corwyn.  Thanks.  Now I just need to freaking stop playing with it and let it sit, until he gets to responding.

  65. Narf says

    @EL (from your comment on Aron’s blog)

    Can you please give me a brief synopsis of what evidence you have that you think should overcome this bias that we all have because of our background knowledge that most people do not rise from the dead?

    I’m pretty certain I know what his evidence is.  To quote Ken Ham, “Bible, Bible, Bible Bible Bible.  Bible.  Oh, and Bible.”

    That’s why he has to argue so hard against dismissing the Gospels and such as evidence.  Without those, he has diddly-squat … and he knows it.

  66. Narf says

    And finished your comment, EL.  Good read.  You pulled your quotes from several different posts of his, didn’t you?  I missed a great deal of the inanity that this guy spouted.  I didn’t even notice his appeal to Social Darwinism and Joseph Stalin.  I wonder if he’s a creationist.  The Social Darwinism crap is usually their thing.

    I think for a lot of his comments, I read the first line or two and went, “Okay, yeah, he’s already off the rails, and he wasn’t talking to me.  So, I don’t give a fuck.”

  67. EnlightenmentLiberal says

    Hmm… I might be able to make Disqus comments readable with greasemonkey. Let’s put my professional expertise to work (and/or reuse someone else’s existing work).

  68. EnlightenmentLiberal says

    Because it annoyed me thus, and because I get fixated on a problem when I go about solving it, here’s what I got.

    Note that this is from someone with basically zero background experience with web design, only minimal knowledge of xml, and zero background experience with javascript. Use the following greasemonkey script at your own peril. Also, I should post this somewhere.

    Because of security something something (skipping details), if you want to use the following greasemonkey script, you have to open the frame containing the comments in its own tab / window.

    To use this greasemonkey script, you have to let the page load, then invoke the “user script command”. For me, that’s located at menu bar -> tools -> greasemonkey -> user script commands -> flatten and sort disqus posts.

    Finally, it will only flatten and sort disqus comments that have loaded. You need to first manually click the “load more comments” button until all of the comments have loaded. Then run my script via the above steps.

    When I feel like it and I get some more time, I’ll try to work around these many limitations.

    On the bright side, it actually seems to work on Aronra’s blog post and comments under discussion.

    Hopefully this doesn’t get mangled.
    Code:
    // ==UserScript==
    // @include http://disqus.com/*
    // @include https://disqus.com/*
    // @grant GM_registerMenuCommand
    // ==/UserScript==

    GM_registerMenuCommand (“Flatten And Sort Disqus Posts”, flattenAndSortDisqusPosts);

    function flattenAndSortDisqusPosts() {
    try {
    console.log(“flattenAndSortDisqusPosts() start”);
    var postListElement = document.getElementById(“post-list”);
    var allComments = getAllComments(postListElement);
    allComments.sort(byId);

    //clear children of comments
    for (var i = 0; i 0)
    childrenNode.removeChild(childrenNode.childNodes[0]);
    }

    //clear post-list node
    while (postListElement.childNodes.length > 0)
    postListElement.removeChild(postListElement.childNodes[0]);

    //add comments in proper order to post-list node
    for (var i = 0; i < allComments.length; ++i)
    postListElement.appendChild(allComments[i]);

    console.log("flattenAndSortDisqusPosts() end");
    }catch(err) {
    console.log("flattenAndSortDisqusPosts(): Error: " + err);
    }
    }

    function byId(a,b) {
    a = a.id;
    b = b.id;
    a = a.substring(5, a.length);
    b = b.substring(5, b.length);
    a = Number(a);
    b = Number(b);
    return a – b;
    }

    function getAllComments(postListElement) {
    var result = new Array();
    getAllComments2(result, postListElement);
    return result;
    }
    function getAllComments2(result, ele) {
    var cl = getClassAttribute(ele);
    if (cl === "post")
    result.push(ele);
    for (var i = 0; i < ele.childNodes.length; ++i) {
    var child = ele.childNodes[i];
    var cl = getClassAttribute(child);
    if (cl === "post" || cl === "children")
    getAllComments2(result, child);
    }
    }

    function getClassAttribute(x) {
    if (x.class)
    return x.class;
    if (x.getAttribute)
    return x.getAttribute("class");
    return "";
    }

    function getChildrenNode(ele) {
    for (var i = 0; i < ele.childNodes.length; ++i) {
    var child = ele.childNodes[i];
    var cl = getClassAttribute(child);
    if (cl === "children")
    return child;
    }
    }

  69. EnlightenmentLiberal says

    Man, I want to severely refactor that code already, lol. Pretty sure I could reduce it by 1/4 approx and make it cleaner in the process.

  70. EnlightenmentLiberal says

    Ok. Here’a a version that kicks off every 0.5 seconds, meaning you don’t need to manually click the button in the menu every time.
    http://pastebin.com/hqEz3L1A
    It still requires that you open the iframe in a new dedicated tab / window.

    Tested only on Firefox.

    Ideally, I would like to figure out how to automate clicking the “load more comments” button, but that’s manageable for now by hand.

  71. Narf says

    Your post seems fine.
    Also, hopefully you can make use of that script to my comment. Just in case, linky:

    Yeah, I already found and read your comment.  The e-mail notification took me right there.

    Bruce said that he responded to your comment, but apparently he did something wrong.  There’s no record of it, even on his profile page.  I guess he’ll have to try that again.  That’s why I compose my comments of any significant length in Word and keep it until I’m sure it went through okay.

  72. Narf says

    Personally, I don’t have that much trouble navigating the comment sections of Disqus, as long as I join them fairly early on. If I need to see stuff in sequence, I can link to the full chain through the commentator’s page.

  73. Narf says

    @aarrgghh

    (hopefully) overactive imagination had me imagining the first caller in some secluded park with some unsuspecting homeless fellow he’s just befriended, playing out his “hypothetical” with matt and jen while fingering the pistol in his pocket and wondering who’s smarter than who …

    Heh heh heh heh.  I didn’t get quite that much of a creepy vibe off of him, but I can see how someone might.  I got more of the whiff of desperation about him, flinging himself out in any direction to try to find any obscene hypothetical that will justify his presupposition.

    Almost like an anarcho-capitalist libertarian.

  74. guyblond says

    Chris has an youtube channel called Hoax Buster Call. He has posted a video: Atheist Experience #933: Logical Fallacies Are Our Bread and Butter.. I left a post asking why he wasn’t over here supporting his position. He responded with the excuse of having a technical problem logging into Freethoughtblogs. I suggested that he probably can work around this some how. Then he came back with that he’s just ends up repeating himself. I then suggested that repeating him self could be a deficiency in communication skills, and maybe he should just give up. It will be interesting to see if he shows up. One might want to jump over and take a look at his channel. I’m kind of wondering if anyone here has had prior experience with Chris?

  75. Narf says

    He responded with the excuse of having a technical problem logging into Freethoughtblogs.

    Had a problem … with logging …

    WHAT?!?!?

    You have an e-mail address, right?  You can make up a display name, right?  What the hell is he talking about?

    I know he was dishonest, but that’s just stupidly so.

  76. guyblond says

    So down below is the whole conversation that I had with Chris on his video about this show. He didn’t ban me, but it look like he’s done with me. Notice that I didn’t beat up on him about his “claims”. I just tried to egg him on to support his positions with those that he is criticizing.

    But if you want more insight about him, go to his channel “Hoax Busters Call.” When I watched the show I was sure that he was going to disprove evolution in order to prove god. But I’m not really sure that this is one of his axes to grind.

    Chris, Why aren’t your over at Freethoughtblogs defending your position on the blog about the show that your called in to?
    Atheist Experience #933: Logical Fallacies Are Our Bread and Butter…

    Hoax Busters Call
    6:53 AM

    +GuyBlondWithOutGod https://www.evernote.com/shard/s103/sh/c05ca2ae-02e5-4328-9f1f-7def73b48df9/ceb73b5d0d374a45

    See the spinning progress wheel at the upper right? That’s all I get. I don’t know what the issue is with their crappy site. I never experience that anywhere else I try to log in to.
    GuyBlondWithOutGod
    8:51 AM

    +Hoax Busters Call It’s a wordpress blog. Pretty standard stuff. Hard to tell whats wrong, maybe your account got corrupted or maybe even hacked. Just set up a different user name and password. Or try form a different computer. If I felt strongly about something I wouldn’t let a little technical problem get in the way of expressing myself to the none choir. Just saying.
    Hoax Busters Call
    9:00 AM

    +GuyBlondWithOutGod I really don’t feel very compelled to engage. I’ll just have to repeat myself over and over, just like I’m doing in the comments. They don’t want a debate or we could do it on a call. I was hung up on, remember?
    GuyBlondWithOutGod
    9:20 AM

    Yeah,that’s a problem, you were just repeating. Writing is always a better means of communication. You have time to get the arguments right. If you just keep repeating after not getting anywhere, then your are just a bad communicator. So maybe your should just give up.
    Hoax Busters Call
    9:22 AM

    Or, maybe they can address the points instead of deflecting, obfuscating and shifting the burden of proof.
    Hoax Busters Call
    9:26 AM

    +GuyBlondWithOutGod The real reason they don’t want a real discussion that is recorded is because they end up looking silly when they end up having to resort to name calling and other fallacious tactics.Watch the video again.
    GuyBlondWithOutGod
    9:48 AM

    +Hoax Busters Call So you give up?
    Hoax Busters Call
    10:05 AM

    +GuyBlondWithOutGod Set me up a working account. And message me the password.Or, you can repost their logically fallacious arguments here then you could relay my answers back to them.
    Oh, yeah, written communication is so much more efficient, right.
    Hoax Busters Call
    10:09 AM

    +GuyBlondWithOutGod Put pressure on Matt to join me in a recorded debate. He can name the time, his topics, as long as he wants to go for. Let’s go! I’ll set aside an entire day for him to get his shit together, we can always pause and resume.
    GuyBlondWithOutGod
    10:21 AM

    +Hoax Busters Call I said better, not more efficient. Maybe effective would have been a better word. What your are suggesting is just silly. Work out your own technical problems. I suspect that your are of adult age?
    Hoax Busters Call
    10:29 AM

    +GuyBlondWithOutGod “Work out your own technical problems” Go get their best argument and repost it here. What’s so difficult about that? Better yet have them work out their own technical issues, if they are not cross platform comparable then that is a web development issue that they need to contend with. I’m sure the problem suits their agenda to suppress discussion. Why not just enable the Youtube comments? They claim the reason is “misogynistic comments”LOL! Oh, those poor sweet delicate babies!

    You’re here to make demands of me? Where exactly do you get off? Why don’t you go find someone who actually has their shit together and have them debate me on a recorded call?
    As Jen says, someone who has the “chops”lol!
    GuyBlondWithOutGod
    10:36 AM

    +Hoax Busters Call Matt has no idea of who I am. So I have no pull with him. If you want to debate him you need to contact him yourself. Or start hitting the blog. The more you are
    in his face the more likely to get his attention. As far as subject goes, he’s
    not going to debate you about evolution. It’s not a field that he has expertise
    in. When he debates, it concerns religion and religious apologetic. But from what I have seen of your language skills, whether your are right or wrong, your going to get slaughtered by Matt.
    Hoax Busters Call
    10:41 AM

    +GuyBlondWithOutGod “So I have no pull with him” Fine, contact someone you know who you do have some pull with.

    ” If you want to debate him you need to contact him yourself” Didn’t I already do that? He hung up on me, remember. It’s on the video. Please watch it first before making more unfounded claims.

    “your going to get slaughtered by Matt.”

    Ha!That’s rich!
    GuyBlondWithOutGod
    11:07 AM

    +Hoax Busters Call I’m not making any demands of you Chris. Do as you will. If you really want to argue your points, your need to do some work.

    The Atheist Experience has posted a statement about why they turn off comments on youtube videos. As a practical matter, even if comments were on, do you have any idea of how many post they would get? How much time do you think Matt or the other Atheist Experience folks have to be reading through hundreds of post on an youtube video? Do you really think that this would be a good forum for your to make your arguments?
    GuyBlondWithOutGod
    11:35 AM

    +Hoax Busters Call I will agree that they mishandled your call. In my view they shouldn’t have let you get past the point of why evolution has anything to do with the subject matter of the show. But I digress.

    So when you say debate, do your use the word to mean any argument? Or do you mean a more formal structured debate? If you mean the former, then yes, you tired to debate and got shut down. But if your mean the other, I never heard you purpose a structured debate. So in that case he hasn’t turned you down.

    If you want to argue with him, just keep calling the show. If you want a structured debate call the show and purpose this.

    Stop being such a wimp!
    Hoax Busters Call
    12:35 PM

    +GuyBlondWithOutGod We’ll see ya!

  77. Monocle Smile says

    @guyblond
    I took a look at Chris’ channel. The guy needs professional help. I’m not about to waste time teaching calculus to a dog that’s just had a stroke.

  78. Monocle Smile says

    Narf, search his channel on YouTube and hit up his G+ page. That’s not a pejorative metaphor I just used. It’s proper identification.

  79. Narf says

    Go get their best argument and repost it here. What’s so difficult about that?

    The guy doesn’t even seem to understand that he’s shifting the burden of proof.  I don’t think he understands what that even means or that he has the positive side in the debate.

    As the ones rejecting his claim, we don’t have to provide shit for an argument.  We just have to rebut his arguments.  You had zero success communicating that to him.

    Fine, contact someone you know who you do have some pull with.

    Umm, how do you even start to address this?  My girlfriend’s little sister’s snake relies on me to feed him dead rats, sometimes.  Does Chris want to debate Tai?

    If you actually had enough pull to get an expert on the subject that Chris wants to debate, you would need to know the subject of the debate ahead of time to know which expert to call in.  Then you would have to figure out how to get your expert to answer your calls, after he/she saw what kind of ignoramus you were trying to set up to oppose the expert in a debate.  I would certainly feel that you were insulting my intelligence and expertise, if you came to me with the proposition.

  80. Narf says

    Narf, search his channel on YouTube and hit up his G+ page. That’s not a pejorative metaphor I just used. It’s proper identification.

    Believe me; I was not questioning the accuracy of your statement.

  81. Supernova Kasprzak says

    The reason Chris from Lawton, OK “appreciates your format” is because he apparently has the same format for his own show… kinda. He goes by the name Hoax Buster Calls on YouTube, and has a copy of his interview on this show. The difference, however, is that he comments on the video so that he can present arguments that his opponents don’t hear or get a chance to respond to.

    After pointing out some of his poor understanding of logic (Matt giving a counterexample to demonstrate his lack of logical consistency became “guilt by associaton”), he asked me to post on his blog (apparently he deletes comments on YouTube that disagree with him) and then practically begged me to call him rather than to respond to my comments. I don’t know why I ever bothered. While I don’t always agree with Matt or Jen, I didn’t hear one unreasonable sentence from either of them, and yet every sentence got attacked by Chris for being logically fallacious. What could I possibly say that he wouldn’t simply declare “fallacious”?

  82. guyblond says

    Here is what Chris added to the comments section of his video after my conversation with him. Interesting how he thinks I speak for other atheist. I thought about pointing out to him that his youtube vid comment section isn’t getting hundred of hits. I guess he doesn’t want the traffic… which mean he isn’t really interested in a conversation. But I really was trying to get him to the table.

    ATTENTION: Atheist will be held to their own standard! If an Atheist would like to leave a comment they need to go to my blog, your comments here will be deleted! Why?Please read…(continued)…
    http://hoaxbusterscall.blogspot.com/2

    Atheist, “GuyBlondWithOutGod” says…”As a practical matter, even if comments were on, do you have any idea of how many post they would get? How much time do you think Matt or the other Atheist Experience folks have to be reading through hundreds of post on an youtube video? Do you really think that this would be a good forum for your to make your arguments?”

  83. guyblond says

    Before I’m finished with the Chris’s call, I have a few other observations.

    I don’t mean this as criticism of the host, but what kind of bothered me about the call was that I don’t think that Matt and Jen handled the it well. They kind of let him get under their skin. Didn’t Jen even drop the F bomb?

    But what caught me ear was Chris’s claim that all he gets from the sources that he has been directed to were claims to back up claims. Clearly, Chris doesn’t understand science.

    I have been thinking a bit about how complex science has gotten and is bound to be more so in the future. It seems to me that we are to the point where major discovers are made by group of people, not individuals. The implication is that any discovery might not be completely understandable by any single individual actually involved in the discovery. If so, how can we expect the lay person to have a grasp of how we have come to the conclusion that something is probably true. How can we expect then to trust that over time we seem to figure out the truth through the scientific process.

    The answer is in the scientific process itself. Chris’s claims about claims isn’t valid about science, but I think it’s reasonable question for someone who doesn’t know about science. This is why I tried to get Chris to call the show again.

    I think Matt and Jen would should have pushed Chris more on why he was calling an atheist show to talk about evolution when it has no bearing on whether or not there is a god. However, I think that fact that many of the callers doubt evolution is an insight into why they accept the god claims.

    In short, I think the Chris’s claims of claims supporting claims deserves to be unpacked. It doesn’t look like this will be done with Chris., because he has it all figured out.

  84. Narf says

    @94 – Supernova Kasprzak

    While I don’t always agree with Matt or Jen, I didn’t hear one unreasonable sentence from either of them, and yet every sentence got attacked by Chris for being logically fallacious. What could I possibly say that he wouldn’t simply declare “fallacious”?

    I get that a lot from half-wits who hear the names of logical fallacies and think they can be all big and philosophical by throwing out accusations of committing those fallacies … but they never actually do the research to learn the slightest details of the fallacy.

    I had one particularly vapid theist over on Aron’s blog (I mean skwills, for those who have been over there, but I’m sure you guys already knew that) who accused someone of making an ad hominem attack against him.

    No, he picked apart your argument, addressing everything you said and explaining why it was stupid.  Then, he called you an idiot.  That isn’t an ad hominem attack; that’s just an insult.  For it to be an ad hominem attack, he has to be just insulting you without actually addressing anything you said.

    He demonstrated that you’re an idiot, before calling you an idiot.  That’s just applying an appropriate label.

    I’ve gotten the same sort of thing in regards to the naturalistic fallacy. I said something along the lines of, “Chimpanzees and bonobos exhibit X behavior, and our recent ancestors seem to have exhibited X behavior.  So, we have to acknowledge that we have a tendency towards X behavior, as a species, and we have to compensate for it in our morality, if we want to curb behavior X.”

    And someone of course trotted out the naturalistic fallacy, which was entirely inappropriate to the argument.  The naturalistic fallacy has a structure: X occurs in nature; therefore we should do X.  What I was proposing was the opposite of the naturalistic fallacy.

  85. Narf says

    @guyblond
    So, basically, he’s trying to take an example of a show that gets tens of thousands of hits, for which the comment section would become a complete cluster-fuck, and he tries to apply it to his channel, which tops out around a couple thousand, except for his 9/11 insanity and Sandy Hook conspiracy stuff.  He’s the worst sort of Alex Jones acolyte.

    Oh, and he has a video called “Nukes Don’t Exist!”  I don’t want to even click on it, because I don’t think my sanity is up to that sort of hit, this early in the day.

    Yeah, this guy is a total nutter.

  86. Narf says

    @91 – Monocle Smile

    Narf, search his channel on YouTube and hit up his G+ page. That’s not a pejorative metaphor I just used. It’s proper identification.

    Yeah, I finally got to checking that out.  I’d have difficulty describing that guy with anything that wasn’t laced with profanity.

    Sorry I tuned out for a bit, on here.  The Freethought Blogs e-mail notification system seems to be fucking up on sending me e-mails, lately.  I had to go back through these and enable notifications through WordPress, with that second check-box below the Post Comment and Preview buttons.  That requires actually leaving a comment.

  87. guyblond says

    @Narf Yep, he’s nutter. Did you get a feeling whether or not he’s got a god believe axe to grind? Or if he generally just got a problem with anything from an authority? Does anybody darn to listen to his show? Wait a minute, why do I care. Maybe I should just toddle off for a little self reflection!

  88. corwyn says

    @ narf:

    For it to be an ad hominem attack, he has to be just insulting you without actually addressing anything you said.

    No, that is still just insulting him. The ad hominem fallacy is if one claims someone is wrong, *because* of .

  89. Narf says

    @101 – corwyn
    Eh, more loosely, it can also just be belittling someone to make him look bad in the eyes of any viewers/listeners, to make them think that he won the argument, when he hasn’t actually addressed a damned thing.  If we’re supposed to be having any kind of organized debate, it has the same function.

    You’d hope that people would understand what was going on and dismiss the attacker entirely and side with the person who actually made an argument, but we’re talking about members of the public, here.  I don’t have much faith in the average person.

  90. Narf says

    @guyblond

    Narf Yep, he’s nutter. Did you get a feeling whether or not he’s got a god believe axe to grind? Or if he generally just got a problem with anything from an authority? Does anybody darn to listen to his show?

    I’m sure not listening to his show.  I need what brain cells I have left, in case Bobby pops his head up again.